Лесной дальневосточный кот: Амурский лесной кот появился в Московском зоопарке впервые за 30 лет

Содержание

Амурский лесной кот появился в Московском зоопарке впервые за 30 лет

Самка дальневосточного (или амурского) лесного кота стала обитательницей Московского зоопарка. В последний раз представители этого вида были в его коллекции более 30 лет назад. Животное считается редким подвидом бенгальского кота. В дикой природе эти коты обитают на Дальнем Востоке, в бассейне реки Амур и на побережье Японского моря. Также их можно встретить в некоторых дальневосточных заповедниках — Ханкайском, Уссурийском, Лазовском и других.

«Наша обитательница приехала к нам в начале осени из Новосибирского зоопарка. Она спокойно относится к людям, с любопытством рассматривает посетителей. Однако если какой-либо громкий звук или неожиданно резкое движение испугают кошку, она тут же спрячется во внутреннем помещении. В остальное время она много играет и исследует вольер: сейчас этой очень активной и подвижной кошечке почти шесть месяцев. К ухаживающим за ней сотрудникам кошка уже привыкла и узнает их», — рассказала Светлана Акулова, генеральный директор Московского зоопарка.

Светлана Акулова отметила, что дальневосточные лесные коты по натуре достаточно скрытны и осторожны. Именно поэтому наблюдать за животным лучше во время показательных кормлений, которые проводятся в экспозиции «Фауна России» в 11:00 со вторника по пятницу. В рацион кошки входит курятина, говядина и злаковые корма.

Дальневосточный лесной кот занесен в Международную Красную книгу, а также в региональную Красную книгу Приморского края. По размеру эти звери сравнимы с домашними котами: их вес не превышает шести килограммов, длина тела равна 75–90 сантиметрам, а роскошный пушистый хвост может достигать 40 сантиметров. Встречаются разные вариации окраса — от золотисто-желтого с серыми вкраплениями до более темного палевого с рыже-коричневыми пятнами.

Живые подарки: как императоры, военные и почитатели пополняли коллекцию зоопарка

Популяция дальневосточных лесных котов в природе постоянно сокращается, прежде всего из-за уничтожения их естественной среды обитания и браконьерства — их незаконно вылавливают, чтобы одомашнить. Однако, подобно манулам, эти кошачьи сложно приручаются и даже выращенные человеком котята с возрастом дичают.

Обычно дальневосточные коты живут в лесах: они прекрасно лазают по деревьям, нередко используя их в качестве засады, чтобы охотиться на зайцев, мелких грызунов и птиц. Также они хорошо плавают и при необходимости ловят рыбу. Самцы и самки находятся на одной территории только в краткий брачный период. Самка в одиночестве обустраивает логово и заботится о потомстве.

Благодаря теплому и густому меху дальневосточные лесные коты хорошо переносят даже самые суровые морозы. А вот сугробы им не по душе: в рыхлом снегу кот будет легко увязать, даже несмотря на сравнительно небольшой вес. Однако если снег достаточно плотный, то животное сможет свободно передвигаться и охотиться.

Московский зоопарк регулярно пополняет коллекцию, которая насчитывает уже более тысячи видов и восьми тысяч особей. В 2017 году здесь впервые появились трубкозуб и три пары папуанских пингвинов.  В этом году в зоосаде поселились два амурских тигра и птица-секретарь. До конца года сюда привезут редких мадагаскарских фосс.

Кроме того, зоопарк участвует в международных программах по сохранению редких и исчезающих видов. Потомство таких животных, появившееся в Московском зоопарке, принимают у себя другие зоосады страны и мира, а Московский зоопарк принимает животных из зоопарков других городов и стран. В частности, в марте амурский тигр Мирон, родившийся в Москве четыре года назад, переехал в зоопарк Копенгагена. 

Дальневосточный лесной кот – фото и описание, чем питается, где обитает, размножение

Дальневосточный кот относится к северному подвиду бенгальской кошки. Удивительные животные имеют яркий, леопардовый окрас, потому их часто называют «амурскими леопардовыми котами». Из-за малой численности млекопитающие занесены в Красную книгу в группу «на грани исчезновения». Лесной кот обитает на Дальнем Востоке и предпочитает жить в густых зарослях кустарника, глухих падях, на лесных опушках, лугах с высокой травой и склонах невысоких гор.

Описание и поведение

Представители семейства кошачьих вырастают до 90 см в длину, весом до 4 кг. Окрас животных варьируется от рыжевато-бурого до серовато-желтого. На теле млекопитающих расположены пятна овальной формы, имеющие четкие или расплывчатые очертания. На горле дальневосточного лесного кота имеется 4-5 ржаво-бурых полос. У животных желтоватые когти, слегка продолговатые, округлой формы уши, длинный и тонкий хвост. Шерсть представителей семейства кошачьих пышная, короткая и густая. В зависимости от времени года волосяной покров меняется по цвету и густоте.

Дальневосточные коты ведут ночной образ жизни. Животные очень осторожны и пугливы, потому хорошо прячутся и охотятся только из засады. В сильные морозы млекопитающие перемещаются поближе к людям и ловят грызунов. Для логова коты используют заброшенные норы барсуков или лис.

Амурский лесной кот отлично лазает по деревьям и плавает. Живут коты либо в одиночестве, либо парами.

Питание лесных кошек

Дальневосточный кот – плотоядное животное. Представители данного вида ловят маленьких зверьков и рептилий, среди которых ящерицы, птицы, земноводные, насекомые и млекопитающие. Леопардовые кошки питаются зайцами, но также не сторонятся растительной пищи. В рационе животных присутствуют яйца, водная добыча, травы.

Особенности размножения

Во время течки между котом и кошкой образуется пара. В некоторых регионах период размножения может длиться круглый год. После зачатия самка вынашивает потомство на протяжении 65-72 дней. Очень редко у неё рождается 4 котенка, чаще всего в помете 1-2 беспомощных, слепых малыша. Молодая мать защищает свое потомство, но в воспитании также принимает участие самец. В полугодовалом возрасте котята покидают убежище и начинают вести самостоятельный образ жизни.

Половое созревание наступает к 8-18 месяцам. Продолжительность жизни дальневосточного кота в неволе составляет 20 лет, в дикой природе – 15-18 лет.

Дальневосточный лесной кот – загадка Красной книги Приморья

Дальневосточный лесной кот. Фото: ИА PrimaMedia

Дальневосточный лесной кот — красивый и грациозный представитель семейства кошачьих, чья популяция страдает от вырубки лесов, пожаров и хищников. Кот занесён в Красную книгу Приморья и находится под охраной в трёх приморских заповедниках. Животное называют загадкой из-за его скрытности и пугливости, сообщает ИА PrimaMedia.

С виду краснокнижный дальневосточный лесной кот напоминает домашнюю кошку. Тем не менее, он отличается строением тела, сильными зубами, длинными усами, окраской, формой ушей и мордочки. Уши у него тупые, мордочка плоская. Длина его тела с хвостом достигает 90 см, вес — 15 кг. Окрас меха серовато-бурый или пепельно-серый с рыжинкой и пятнами. Китайцам эти пятна напоминают монеты, поэтому животное иногда называют денежной кошкой. На голове у дальневосточного лесного кота тёмные и светлые полосы, на лбу — две белые вертикальные стрелки, а на хвосте — расплывчатое кольцо.

Этот редкий вид селится обычно у рек, в заболоченных низинах. В тайге и горах появляется не часто — там он проваливается в сугробы и не может охотиться. Как только выпадает рыхлый снег, лесной кот прячется в чужие норы или дупла.

В Приморье кот обитает в заповеднике «Кедровая Падь», а также в Уссурийском, Лазовском и Ханкайском заповедниках. Правда встретить его — большое везение, говорят лесники, краеведы и заядлые охотники. Дальневосточные лесные кошки считаются одними из самых скрытных и пугливых в семействе. Встречаться и знакомиться с человеком они не желают, поэтому их называют загадкой Красной книги. Их скрытностью объясняется то, что точных сведений о численности популяции нет, следы встречаются так же редко. Даже Ричард Маак, впервые рассказавший об этом виде в 1859 году, не видел их своими глазами, а описывал шкурки, взятые у аборигенов.

В неволе понаблюдать за этими прекрасными животными можно в двух парках недалеко от Владивостока: в Шкотовском сафари-парке, а также в недавно открывшемся парке «Белый лев» недалеко от Кипарисово.  

Пропитания таинственному зверю хватает — в лесу полно мышей, белок, ежей, птиц и яиц, зайцев. Но так же много в лесу врагов: соболей, рысей, росомах, волков, сов, орланов, беркутов. Это влияет на уменьшение популяции редкого вида. Одним из главных факторов сокращения численности котов также является человеческая деятельность, а именно вырубка лесов, поджоги, освоение под сельское хозяйство равнинных пространств.

Сегодняшний краснокнижный статус зверька предусматривает приличный штраф за его истребление. Животное охраняется в трех заповедниках Приморья — «Кедровая падь», Уссурийском имени В. Л. Комарова и Лазовском имени Л. Г. Капланова. Кроме того, кот внесён и в приложение II Конвенции СИТЕС. Благодаря заповедникам и зоопаркам этот исчезающий вид семейства кошачьих удалось сохранить.

Материал подготовлен в рамках проекта ИА PrimaMedia «Чистый край». Его цель — формирование бережного отношения к природе, среде проживания и экологии, сохранение лесных, водных и иных природных богатств Российской Федерации, вовлечение как можно большего числа приморцев в природоохранную деятельность, формирование экологического сознания.

В Приморье краснокнижного лесного кота выпустили в лес после реабилитации

https://ria.ru/20210819/kot-1746383846.html

В Приморье краснокнижного лесного кота выпустили в лес после реабилитации

В Приморье краснокнижного лесного кота выпустили в лес после реабилитации — РИА Новости, 19.08.2021

В Приморье краснокнижного лесного кота выпустили в лес после реабилитации

Редкого дальневосточного лесного кота, который угодил в капкан в курятнике после неудачной охоты на кур, выпустили в природу после реабилитации в Приморье,… РИА Новости, 19.08.2021

2021-08-19T16:53

2021-08-19T16:53

2021-08-19T17:20

хорошие новости

общество

россия

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn24.img.ria.ru/images/07e5/08/13/1746386290_0:0:640:360_1920x0_80_0_0_d415e771c246cca1bc2ce7ba2ec8ec09. jpg

ВЛАДИВОСТОК, 19 авг — РИА Новости. Редкого дальневосточного лесного кота, который угодил в капкан в курятнике после неудачной охоты на кур, выпустили в природу после реабилитации в Приморье, сообщает МРОО «Центр «Тигр».Ранее сообщалось, что специалисты центра выхаживают дальневосточного лесного кота, который попал в капкан в курятнике. Очередная охота на кур завершилась не в пользу хищника, и он оказался в МРОО «Центр «Тигр», где прошел курс реабилитации. Зверь ел с аппетитом, но был «крайне недоволен сложившейся ситуацией», выражая свое настроение «грозным» шипением. Ветеринары обследовали кота после реабилитации и установили, что хищник здоров, кости капканом не повреждены.»Прощай, милый кот. Беги навстречу свободе. Доброй охоты. Мы благодарим всех, кто оказывал нам финансовую и информационную поддержку. Благодаря вашей помощи мы можем продолжать нашу работу по спасению животных», — сообщил центр на своей странице в Instagram.Пост в соцсети сопроводили фото и видео выпуска. На фотографии видно, как дальневосточный лесной кот жаждал вернуться в лес, куда устремил свой взгляд, вцепившись лапами в прутья клетки.

Выпуск занял несколько секунд: едва открылась дверца, краснокнижный хищник, распушив хвост, в три прыжка достиг зарослей и скрылся в лесу.Дальневосточный лесной кот занесен в Красную книгу России. По данным на 2015 год популяция животного не превышает нескольких тысяч особей.Центр реабилитации тигров и других редких животных в Приморье создан в 2012 году, здесь прошли реабилитацию порядка десяти тигров и африканский лев. Многих тигров выпустили в дикую природу, большинство из них адаптировались, часть принесла потомство. Также в центре периодически проходят реабилитацию медвежата-сироты, которых спасают местные жители, и другие дикие животные и птицы, которых после восстановления выпускают в лес.

https://ria.ru/20210810/ovtsebyk-1745135258.html

https://ria.ru/20210727/moskva-1743063981.html

россия

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2021

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Редкого лесного кота выпускают в лес после реабилитации

Редкого дальневосточного лесного кота, который угодил в капкан в курятнике после неудачной охоты на кур, выпустили в природу после реабилитации в Приморье.

2021-08-19T16:53

true

PT0M14S

https://cdn24.img.ria.ru/images/07e5/08/13/1746386290_81:0:561:360_1920x0_80_0_0_d43402dab43cb33813775ff5737eb204.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

общество, россия

16:53 19.08.2021 (обновлено: 17:20 19.08.2021)

В Приморье краснокнижного лесного кота выпустили в лес после реабилитации

ВЛАДИВОСТОК, 19 авг — РИА Новости. Редкого дальневосточного лесного кота, который угодил в капкан в курятнике после неудачной охоты на кур, выпустили в природу после реабилитации в Приморье, сообщает МРОО «Центр «Тигр».

Ранее сообщалось, что специалисты центра выхаживают дальневосточного лесного кота, который попал в капкан в курятнике. Очередная охота на кур завершилась не в пользу хищника, и он оказался в МРОО «Центр «Тигр», где прошел курс реабилитации. Зверь ел с аппетитом, но был «крайне недоволен сложившейся ситуацией», выражая свое настроение «грозным» шипением. Ветеринары обследовали кота после реабилитации и установили, что хищник здоров, кости капканом не повреждены.

10 августа, 09:17Хорошие новостиВ Московском зоопарке родился теленок краснокнижного овцебыка»Прощай, милый кот. Беги навстречу свободе. Доброй охоты. Мы благодарим всех, кто оказывал нам финансовую и информационную поддержку. Благодаря вашей помощи мы можем продолжать нашу работу по спасению животных», — сообщил центр на своей странице в Instagram.

Пост в соцсети сопроводили фото и видео выпуска. На фотографии видно, как дальневосточный лесной кот жаждал вернуться в лес, куда устремил свой взгляд, вцепившись лапами в прутья клетки. Выпуск занял несколько секунд: едва открылась дверца, краснокнижный хищник, распушив хвост, в три прыжка достиг зарослей и скрылся в лесу.

Дальневосточный лесной кот занесен в Красную книгу России. По данным на 2015 год популяция животного не превышает нескольких тысяч особей.

Центр реабилитации тигров и других редких животных в Приморье создан в 2012 году, здесь прошли реабилитацию порядка десяти тигров и африканский лев. Многих тигров выпустили в дикую природу, большинство из них адаптировались, часть принесла потомство. Также в центре периодически проходят реабилитацию медвежата-сироты, которых спасают местные жители, и другие дикие животные и птицы, которых после восстановления выпускают в лес.

27 июля, 11:17Москва Сегодня: мегаполис для жизниВ Москве у 25 видов краснокнижных птиц появились птенцы

Дальневосточный лесной кот — это… Что такое Дальневосточный лесной кот?

Дальневосточный лесной кот

?

Дальневосточный кот
Научная классификация
Латинское название
Prionailurus bengalensis euptilurus Elliot,
1871
Синонимы
  • Prionailurus bengalensis euptilura
  • Felis bengalensis euptilura

Дальневосточный кот (лат. Prionailurus bengalensis euptilurus или лат.  Felis bengalensis euptilura) — подвид бенгальской кошки. Другое название — «амурский леопардовый кот».

Немного крупнее домашней кошки. Длина его тела 75—90 см, хвоста — 35—37 см, вес 4—6 кг. Основная окраска шерсти верхней стороны светлая серовато-жёлтая или тусклая серовато-бурая с рассыпанными округлыми темно-рыжими пятнами. Распространен на Дальнем Востоке, в бассейне реки Амур и по побережью Японского моря. Вблизи озера Ханка кот встречался по всей пригодной для обитания площади. Обитает в Большехехцирском, Ханкайском, Уссурийском, Кедровая Падь, Лазовском заповедниках.

Питается мышами, полевками, белками, птицами, изредка нападает на зайцев и молодых косуль. Спаривание происходит в марте. Беременность длится 65—70 дней, кошка приносит до четырёх котят, в воспитании которых принимает участие и самец. Продолжительность жизни — 17—18 лет.

Редкий подвид, внесен в Красную книгу Приморского края.

Серебряная памятная монета, выпущенная в 2004 году

Ссылки

Категории:
  • Животные по алфавиту
  • Кошачьи
  • Млекопитающие Азии
  • Фауна Дальнего Востока
  • Животные, описанные в 1871 году

Wikimedia Foundation. 2010.

  • Фантазия (значения)
  • Утзон, Йорн

Смотреть что такое «Дальневосточный лесной кот» в других словарях:

  • дальневосточный лесной кот — amūrinė katė statusas T sritis zoologija | vardynas taksono rangas rūšis atitikmenys: lot. Felis euplitura rus. азиатский лесной кот; амурская кошка; амурский лесной кот; бенгальская кошка; дальневосточный кот; дальневосточный лесной кот ryšiai:… …   Žinduolių pavadinimų žodynas

  • азиатский лесной кот — amūrinė katė statusas T sritis zoologija | vardynas taksono rangas rūšis atitikmenys: lot. Felis euplitura rus. азиатский лесной кот; амурская кошка; амурский лесной кот; бенгальская кошка; дальневосточный кот; дальневосточный лесной кот ryšiai:… …   Žinduolių pavadinimų žodynas

  • амурский лесной кот — amūrinė katė statusas T sritis zoologija | vardynas taksono rangas rūšis atitikmenys: lot. Felis euplitura rus. азиатский лесной кот; амурская кошка; амурский лесной кот; бенгальская кошка; дальневосточный кот; дальневосточный лесной кот ryšiai:… …   Žinduolių pavadinimų žodynas

  • Амурский лесной кот — ? Амурский лесной кот …   Википедия

  • Кот (значения) — Кот: В Викисловаре есть статья «кот» Кот  самец кошки. Дикие коты Дальневосточный лесно …   Википедия

  • дальневосточный кот — amūrinė katė statusas T sritis zoologija | vardynas taksono rangas rūšis atitikmenys: lot. Felis euplitura rus. азиатский лесной кот; амурская кошка; амурский лесной кот; бенгальская кошка; дальневосточный кот; дальневосточный лесной кот ryšiai:… …   Žinduolių pavadinimų žodynas

  • Дальневосточный кот — ? Бенгальская кошка Бенгальская кошка Научная классификация Царство: Животные Тип …   Википедия

  • Барнаульский зоопарк — Координаты: 52°36′17.27″ с.  ш. 39°36′27.77″ в. д. / 52.604799, 39.607715  …   Википедия

  • СССР. Животный мир —         В связи с большим разнообразием условий, как на суше, так и в морях и со значительным протяжением территории с С. на Ю. и с З. на В. животный мир СССР весьма разнообразен. Вместе с тем из за северного положения большей части территории… …   Большая советская энциклопедия

  • Felis euplitura — amūrinė katė statusas T sritis zoologija | vardynas taksono rangas rūšis atitikmenys: lot. Felis euplitura rus. азиатский лесной кот; амурская кошка; амурский лесной кот; бенгальская кошка; дальневосточный кот; дальневосточный лесной кот ryšiai:… …   Žinduolių pavadinimų žodynas

Дальневосточный лесной кот

Дальневосточный лесной кот, другое название амурский леопардовый кот — подвид бенгальской кошки.

Внешний вид

Размер тела амурского леопардового кота 75-90 сантиметров, хвоста — 35-37 сантиметров.

Вес самца — до 15 кг.

У него сравнительно длинные ноги, небольшая голова, тонкий хвост. Волосяной покров пышный, густой, мягкий. Длина направляющих остевых волос на спине достигает 49 миллиметров. Основная окраска шерсти верхней стороны светлая серовато-желтая или тусклая серовато-бурая с рассыпанными округлыми темно-рыжими пятнами расплывчатого или четкого очертания. Спина у дальневосточного лесного кота немного темнее боков. Бока книзу постепенно светлеют. Вдоль спины леопардового кота тянутся три бурые полосы, эти полосы образованы удлиненными узкими пятнами. Бывает что все три полосы расплывчатые и сливаются в один широкий ремень. На горле кота расположены четыре — пять ржаво-бурых поперечных полос, ряды пятен образуют также поперечные полосы на передних ногах. Живот грязновато-белый с желтым оттенком. Китайцы называют этот вид «денежной кошкой», поскольку пятна на его шерсти напоминают старинные китайские монеты. От внутренних углов глаз вверх по лбу и далее по темени проходят параллельно две белые полосы, между которыми находится рыжевато-коричневая полоса, идущая от носа через лоб и темя к шее. Хвост темно-серый, иногда одноцветный, чаще на нем бывает до семи черно-серых неполных колец. Кончик хвоста чисто черный или темно-серый.

Среда обитания

Этот вид диких кошек распространен на Дальнем Востоке, по побережью Японского моря и в бассейне реки Амур. Ареал дальневосточного лесного кота простирается через весь Китай, к западу вплоть до Индостана и к югу до Малайского архипелага.

Населяет дальневосточный лесной кот глухие горные леса, отчасти заросли кустарников.

Образ жизни, питание

Дальневосточный лесной кот ведет сумеречный и ночной образ жизни. Пуглив и очень осторожен, его трудно обнаружить. Охотится из засады (на земле и деревьях), добычу настигает одним прыжком.

В зимнее время мигрирует с гор на речные и озерные долины, вершины холмов, покрытых плотным кустарником (там, где снег сдувается ветром и хорошо уплотнен).

В сильные морозы может подходить к человеческому жилью и охотится в старых зданиях на синантропных грызунов. Во время опасности спасается на деревьях.

Убежище устраивает в дуплах старых деревьев и расщелинах скал, скрытых в густом кустарнике. Охотно использует заброшенные норы лис и барсуков. Дно логова выстилает сухой травой и листвой, древесной трухой.

Отлично лазает по скалам и деревьям, хорошо плавает.

У амурского лесного кота на участке несколько временных убежищ, которые он периодически посещает. Зимой же использует только одно постоянное и самое безопасное логово.

Живет дальневосточная лесная кошка парами или в одиночку. Только в сезон размножения вместе собирается несколько кошек.

Индивидуальный участок одной особи в среднем занимает 5-9 км2 и зависит от обилия добычи.

Продолжительность жизни в природе 15-18 лет.

Питается мелкими грызунами: полевками, мышами, белками, также ловит птиц, иногда нападает на зайцев, молодых косуль. Диету часто дополняют травы, яйца, птицы и водные добычи.

В многоснежные зимы амурский леопардовый кот вынужден держаться вблизи мест проживания человека.

Размножение и продолжительность жизни дальневосточного лесного кота

Спаривание у дальневосточных котов происходит ранней весной — в марте.

Беременность у самок длится 65-70 дней. Обычно котята появляются во второй половине мая. В помете 1-2 (иногда до 4) слепых и беспомощных котенка, весящих по 75-80 г. Глаза открываются на 10 день. Самка активно защищает котят и в случае опасности переносит их в другое место. Когда котятам исполнится 45-50 дней, они начинают выходить из логова и обследовать прилегающую территорию. В 4-4,5 месяца вес молодых котов достигает 3,2 кг, самок до 2,4 кг. В возрасте 6 месяцев (октябрь-ноябрь) котята покидают мать в поисках своего охотничьего участка. Половое созревание наступает по одним данным в 8-10 месяцев, по другим только к 18 месяцам.

В воспитании котят принимает участие и кот-отец.

Дальневосточный лесной кот в неволе

Лесного дальневосточного кота можно содержать как непосредственно в доме в качестве домашнего питомца, так и в качестве вольерного животного в вольере.

Для домашнего содержания лучше подобрать котенка до 3-х месяцев, выращенного в питомниках домашнего типа. Но и в этом случае по достижении половой зрелости кот может стать неуправляемым.

Амурский леопардовый кот достаточно неплохо приручаются к лотку. Обычно кошка привыкает к определенным членам семьи, а других людей сторонится.

При вольерном содержании, кошке необходимо соорудить вольер с минимальным размером 1,5х3х1,5м. Размер ячейки от 15х15 до 50х50 мм. Пол должен быть либо деревянным, либо бетонным (дерево предпочтительнее в холодный сезон). Иногда в уличные вольеры на бетон насыпают слой земли или песка.

Для поддержания чистоты в вольере желательно использовать поведенческие особенности кошек — создание «уборной», под которую в условиях вольера приспосабливают лоток с песком или опилками. В вольере необходимо установить укрытие. Это может быть деревянная будка с подстилкой внутри (солома, или ветошь).

В вольерах устанавливают полки на разной высоте или вертикально и горизонтально спилы деревьев соответствующего диаметра. При большой площади вольеры и высоте её не менее пяти метров для кошек устраивают деревянные или каменные террасы у задней стенки.

Кормление в неволе

Основной корм дальневосточного лесного кота в неволе – нежирные сорта мяса, такие как говядина, но без живого корма – крыс, мышей, суточных цыплят и перепелов поддерживать нормальную физиологическую активность и размножение животных сложно, тем более, поведенческие особенности хищника притупляются, что ведёт к «навязчивым движениям», скуке животного. Кроме того, животное поедает не только парное мясо, но и содержимое кишечника, мозг, часть шкуры с шерстью (пером) «живых» кормов. Считается, что для полноты белкового обмена, раз в неделю желательно предлагать рыбу. Но не постоянно. Избыток рыбы в питании может привезти к вымыванию кальция из организма животного и соответственно к связанным с этим заболеваниям, таким как рахит.

Для ежедневного кормления дальневосточного лесного кота достаточно 2-х мышей, или одну крысу и около 200гр. нежирного мяса. Кормят один раз в день.

Не менее важной составляющей кормления является еженедельный разгрузочный или «голодный» день, когда животному (кроме самок в период лактации и котят до полугодовалого возраста) не дают мяса и живых кормов. Однако, некоторые специалисты, раз в неделю, в дополнение к «голодному» дню устраивают и «полуголодный» день, когда норма мяса или живых кормов выдаётся в половинной норме. Это важно, так как в условиях неволи кошки не тратят так интенсивно энергию как на воле и поэтому часто жиреют, заболевают и даже умирают.

При содержании кошек в помещении, в хорошую погоду необходимо их периодически выгуливать на свежем воздухе. На улице кошка получает естественный ультрафиолет (что крайне необходимо для выработки витамина D, что в свою очередь позитивно влияет на здоровье), кормится луговой травой (выискивая нужные травы для организма), знакомится с новыми запахами. Выгул «домашних» кошек важен для полноценного физического и психо-эмоционального развития животного.

Продолжительность жизни в неволе – 20 лет.

Статус популяции и охрана

Дальневосточный лесной кот занесен в Красную книгу РФ, Конвенцию CITES (Приложение II). Численность популяции в последние годы начала расти, но тем не менее он все еще является редким представителем семейства кошачьих.

Основные угрозы виду: потеря среды обитания (пожары, рубка леса, распашка целинных участков с высокотравьем, охота), погодные факторы, гибридизация с домашними кошками.

Уссурийский амурский лесной кот | Красная книга

Отряд: Хищные — Carnivora
Семейство: Кошачьи — Felidae
СТАТУС: Малочисленные виды (II категория)

В России ареал вида включает большую часть территории Приморского края, некоторые южные районы Хабаровского края и Амурской обл.; он разделен на две неравные по площади части, соединяющиеся за пределами нашей страны. Западная граница ареала начинается от устья Зеи, или немного восточнее, идет вдоль Амура в нескольких десятках километров от реки, а в южной излучине немного удалясь от нее, затем поворачивает на юго-восток и, пересекая реку ниже устья Б. Биры, уходит в КНР. Граница ареала вида снова входит в пределы России южнее Хабаровска и по правому берегу реки тянется приблизительно до устья р. Гура. Отойдя несколько к востоку, она резко поворачивает на юг,пересекает верхнее течение Анюя, Хора, Бикина и Бол. Уссурки и, следуя на расстоянии 120 — 150 км от Уссури, достигает примерно 45 град. с. ш. Затем, пересекая Сихотэ-Алинь, поворачивает на север-восток и уже по восточному склону этого хребта подходит к Татарскому проливу в районе устья Ботчи. Зимой 1970 — 1971 гг. при детальном обследовании низовьев Бикина признаков присутствия лесного кота не обнаружено. Отсутствует он и севернее устья Бикина (4). Вне России ареал вида включает северо-восточные и восточные области КНР (на юге до Янцзы), Корейский полуостров и некоторые острова в Корейском проливе. Этот подвид чаще встречается в разреженных широколиственных лесах, реже — в кедрово-широколиственных лесах, предпочитая глухие пади, в закустаренных долинах рек, в тростниковых зарослях по берегам озер и стариц. На побережье Японского моря обитает на старых гарях, охотно селится на лесных вырубках, по опушкам леса, граничащим с полями, среди скал и россыпей, но в горы обычно не поднимается выше 500 м над ур. моря. Избегает темнохвойной тайги.

Численность популяции

Систематических наблюдений за численностью лесного кота на больших площадях не проводилось. Некоторые сведения собраны при устройстве охотничьих промхозов Приморского края в 1964 — 1973 гг. В Хасанском, Надеждинском и Шкотовском районах общая численность этих котов была определена в 200 — 250 особей; в Уссурийском районе — в 190 — 230, в Анучинском — в 30 — 40, в окрестностях Арсеньева — в 30 — 35. Вблизи оз. Ханка кот встречался по всей пригодной для обитания площади; только в Приханкайском госпромхозе насчитывалось не менее 120 хищников. К северу от оз. Ханка плотность населения животных заметно снижается, а в нижней части бассейна Большой Уссурки отмечались единичные встречи (4). В заповеднике «Кедровая падь» кот был весьма обычным, плотность его достигала 5 особей на 1000 га . В Лазовском заповеднике и его окрестностях численность вида очень мала (5). В последние десятилетия, преимущественно под влиянием антропогенных факторов, происходит почти повсеместное снижение численности вида. Местами кот исчез или стал очень редким.

Лимитирующие факторы

 Кот не приспособлен к жизни в многоснежных районах прежде всего из-за неспособности добывать в этих условиях основную пищу — мышевидных грызунов. В последние годы усиливается сокращение площадей естественных местообитаний вследствие вырубки кустарников, распашки целинных участков с высокотравьем и выжигания колков. На численности и распространении кота отрицательно сказываются интенсивное хозяйственное освоение южных районов Дальнего Востока, лесные пожары, интенсивный капканный промысел пушных зверей, отлов зайцев петлями, что обусловливает случайную поимку котов, преследование их собаками, имеющимися на пасеках и сопровождающих пастухов и охотников. Дикая кошка трудно приспосабливается к изменениям в природных ландшафтах, вносимых деятельностью человека.

Охрана

Меры охраны. Для спасения уссурийского кота, помимо полного запрещения промысла и борьбы со случайным отловом, нужна широкая разъяснительная работа среди населения, и прежде всего среди охотников, о значении этого хищника как истребителя вредных грызунов, о роли его при ограниченной численности в охотничьем хозяйстве, о важности сохранения вида в составе местной фауны. Обитает в Большехехцирском, Ханкайском, Уссурийском, Кедровая Падь, Лазовском заповедниках.

Амурский леопардовый кот или дальневосточный лесной кот — тигры и другие дикие кошки

В то время как леопардовая кошка — одна из самых распространенных мелких кошек в Азии, ее подвид Euptilura , широко известный как амурская леопардовая кошка или дальневосточная лесная кошка, встречается реже. Euptilura больше, чем многие подвиды азиатских леопардовых кошек. Он также отличается по внешнему виду. Это плотная, короткая, обычно розеточная шерсть, более красная и серая, чем у других подвидов. У эуптилуры тяжелые кости и мускулы, длинные ноги, маленькая голова и толстый хвост.

Еще один представитель семейства кошачьих леопардовых кошек Цусима обитает исключительно на острове Цусима, острове японского архипелага, расположенном в центре Цусимского пролива. Первоначально эта кошка относилась к подвидам китайского леопарда, но теперь считается изолированной популяцией амурской кошки ( P. b. Euptilurus / euptilura ).

Распределение

Прозвище «Амурский леопардовый кот» дано потому, что он обычно встречается в долине реки Амур на Дальнем Востоке России.Река Амур (эээ Мавр) — огромная река в Восточной Сибири. Система реки Амур имеет длину около 2744 миль. Река течет на восток вдоль северной границы Китая, а затем поворачивает на север в Хабаровский край России. Он впадает в северный Татарский пролив, узкую полосу воды, отделяющую остров Сахалин от восточного побережья Сибири. Долины Амура и его рукавов занимают около 715 000 кв. Миль. Города Хабаровск и Комсомольск стоят на берегу Амура.

Среда обитания и диета

Этого кота сложно найти.Обычно встречается в горных лесах, а иногда и в густых зарослях. Сообщалось о наблюдениях в изолированных холмистых лесах прибрежной низменности озера Ханка в Уссуриленде, Россия. Они питаются мелкими млекопитающими, такими как мыши, белки, зайцы, молодняк косули и птиц, мелкие рептилии и земноводные.

Репродукция

Спаривание обычно происходит в марте, а в мае рождается в среднем четыре котенка. У этих кошек самцы помогают в воспитании молодняка.

Угрозы

Основная угроза, с которой эти кошки сталкиваются в Уссуриленде, на юге Дальнего Востока России, — это потеря среды обитания.Южный Уссуриленд особенно отличается разнообразной флорой и фауной со смесью сибирских и восточных видов. Сосна корейская ( Pinus koraensis ), известная в местном масштабе как «кедр», вырубалась, несмотря на то, что она важна как источник пищи для диких животных. Сейчас большинство старовозрастных лесов за пределами заповедников вырублено, а то, что осталось, относительно хорошо защищено. Сейчас наиболее серьезной проблемой является стремительное развитие района. В течение десятилетия местная популяция змей, лекарственных растений, кабарги ( Moschus moschiferus ) и медведей ( Ursus arctos , U.tibetanus ) рухнули.

В Московском зоопарке появился леопардовый кот / Новости / Сайт Москвы

Самка дальневосточного лесного кота (амурская леопардовая кошка) приехала жить в Московский зоопарк. Раньше в зоопарке был этот вид кошек, но это было более тридцати лет назад. Это животное считается редким подвидом бенгальской кошки. В дикой природе ареал таких кошек охватывает Дальний Восток, бассейн реки Амур и побережье Японского моря. Также их можно встретить в некоторых дальневосточных заповедниках, таких как Ханка, Уссури, Лазовский и других заповедниках.

«Наша кошка приехала сюда ранней осенью из Новосибирского зоопарка. Она спокойно относится к людям и с любопытством наблюдает за посетителями. Однако, если ее напугает громкий звук или резкое движение, она сразу же войдет внутрь и спрячется. Она много играет и исследует свой вольер. Этой очень активной и подвижной кошке почти полгода. Она уже привыкла к работникам зоопарка, которые заботятся о ней и узнают их », — сказала Светлана Акулова, генеральный директор Московского зоопарка.

Светлана Акулова отметила, что дальневосточные лесные леопардовые кошки довольно скрытны и осторожны.Поэтому лучше всего наблюдать за ними, когда их кормят в 11 утра на выставке «Фауна России» со вторника по пятницу. В рацион кошки входят курица, говядина и крупы.

Дальневосточная лесная кошка внесена в Международный, а также Приморский Красный список видов, находящихся под угрозой исчезновения. Он размером с домашнюю кошку: его вес не превышает шести килограммов, длина тела составляет 75–90 см, а его пушистый хвост может достигать длины до 40 см. Цвет их меха может варьироваться от золотисто-желтого с серыми пятнами до более темного соломенного цвета с песочно-коричневыми пятнами.

В дикой природе популяция дальневосточных лесных кошек постоянно сокращается, прежде всего из-за разрушения их естественной среды обитания, а также браконьерства: их незаконно вылавливают для приручения. Однако этот вид, как и кошек Палласа, трудно приручить, и даже котята, выращенные человеком, со временем одичают.

Обычно они живут в лесу: отлично лазают по деревьям, часто используют их для засад и охоты на зайцев, мелких грызунов, а также птиц.Также они хорошо плавают и при необходимости ловят рыбу. Самцы и самки остаются на одной территории только в течение короткого брачного сезона. Самки строят свои берлоги и самостоятельно ухаживают за своим потомством.

Благодаря теплой и густой шерсти дальневосточные лесные кошки прекрасно переносят даже самые суровые морозы. Но они не любят груды снега: кошка вполне может застрять в мягком снегу, несмотря на его легкий вес. Но если снег утрамбован, кошки могут свободно передвигаться и охотиться.

Московский зоопарк регулярно пополняет свою коллекцию, которая сейчас насчитывает более тысячи видов и более восьми тысяч животных.Впервые сюда завезли трубкозуба и трех папуасских пингвинов в 2017 году. В этом году в зоопарке находились два амурских тигра и птица-секретарь. Редкие мадагаскарские окаменелости будут доставлены в зоопарк до конца года.

Кроме того, зоопарк участвует в международных программах по сохранению редких и исчезающих видов. Их потомство, появившееся в Московском зоопарке, размещают в зоопарках страны и за ее пределами, а в Московский зоопарк принимают животных из других городов и стран.В частности, Амурский тигр Мирон, родившийся четыре года назад в Москве, в марте переехал в Копенгаген.

Как Московский зоопарк будет работать в зимний период Как спят жирафы и чем питаются капибары: доступны аудиогиды о животных зоопарка

Все 40 видов диких кошек и где их увидеть в дикой природе

От крошечного ржаво-пятнистого кота из Шри-Ланки до огромного сибирского тигра на Дальнем Востоке в мире существует 40 видов диких кошек, и каждый из них столь же красив, сколь и уникален.

Большинство из нас знает львов, тигров, ягуаров и леопардов, но что есть все остальные виды диких кошек? Если вы считаете себя кошачьим человеком или просто интересуетесь этими харизматичными животными, читайте дальше, чтобы познакомиться с семьей.

Несколько лет назад я поставил перед собой амбициозную цель — увидеть все виды диких кошек в их естественной среде обитания. Этот квест, вероятно, займет всю жизнь — некоторые виды диких кошек настолько неуловимы, что их почти никогда не увидеть. На данный момент мне удалось выследить 17 видов кошек.Ниже я предлагаю советы по лучшим турам и направлениям для всех, кто хочет пойти по моим стопам и наблюдать за дикими кошками в их стихии.

Ягуар в бразильском Пантанале

Некоторые из лучших книг о семействе кошачьих

Во-первых, несколько часто задаваемых вопросов о диких кошках

Сколько существует видов диких кошек?

Хотя общее количество признанных видов диких кошек варьируется, восемь линий, составляющих семейство Felidae, широко распространены. По состоянию на ноябрь 2017 года Группа специалистов по кошкам Международного союза охраны природы (МСОП) признала 41 вид семейства Felidae (включая домашних кошек).

Семейство Felidae состоит из двух подсемейств: Pantherinae, которое составляет 7 больших кошек, и Felinae, которое представляет 33 маленьких кошек.

Какие 7 больших кошек?

Семь больших кошек — крупнотелые кошачьи, принадлежащие к подсемейству Pantherinae. Это: лев, тигр, ягуар, леопард, снежный барс, дымчатый леопард, зондский дымчатый леопард

Какая самая редкая дикая кошка?

Трудно быть уверенным, что это самая редкая дикая кошка на Земле, потому что мы просто недостаточно знаем о популяциях некоторых из самых редких кошачьих.Амурский леопард, безусловно, одна из самых редких кошек, в дикой природе на Дальнем Востоке России сохранилось не более 90 особей.

В дикой природе может остаться еще меньше иранских гепардов, но данные об иранском гепарде отсутствуют из-за проблем с проведением полевых исследований в политически нестабильном регионе.

Южно-китайский тигр, возможно, уже вымер, поскольку с конца 1980-х годов дикие особи не регистрировались.

Какие виды диких кошек находятся под наибольшей угрозой исчезновения?

На уровне видов в Красном списке видов, находящихся под угрозой исчезновения МСОП, перечислены пять видов кошачьих, находящихся под угрозой исчезновения: тигр, иберийская рысь, залив Борнео, кошка-рыболов и кошка с плоской головой.

Вот разбивка нижней классификации диких кошек, включая список всех 40 видов диких кошек (не считая домашних кошек). Нажмите на название вида или прокрутите вниз, чтобы увидеть описание, изображение и советы о том, где его увидеть в дикой природе.

Виды больших кошек — Panthera Lineage

Большие кошки — одни из самых харизматичных животных на земле и одни из самых исчезающих. Так что же такое 7 больших кошек? Это крупные кошки, принадлежащие к подсемейству диких кошек Pantherinae.

Тигр ( Panthera tigris ) Амурский тигр (стоковое изображение)

Статус МСОП: Под угрозой исчезновения

При весе 320 кг сибирский тигр — самая большая кошка в мире. К сожалению, тигр также является самой большой кошкой, находящейся под угрозой исчезновения. Еще в первой половине прошлого века тигры жили в Турции и на индонезийских островах Бали и Ява. Эти три подвида сейчас вымерли. Южно-китайский тигр уже пересек точку невозврата: около 20 особей остались в дикой природе.Остальные пять подвидов находятся на разных стадиях упадка.

Мы также почти потеряли амурского тигра, но, к счастью, в последние несколько десятилетий на Дальнем Востоке России были приняты интенсивные меры по сохранению, и царь сибирской тайги был возвращен на грань исчезновения.

Сегодня большинство оставшихся тигров принадлежат к бенгальскому подвиду, который встречается по всему Индийскому субконтиненту. Неудивительно, что Индия — лучшее место в мире, чтобы увидеть тигров в дикой природе.Канха и Бандхавгарх в штате Мадхья-Прадеш — одни из лучших национальных парков Индии для наблюдения за тиграми в дикой природе.

Я посетил Канху несколько лет назад и видел в общей сложности 15 тигров за 7 дней. Были замечены отдельные особи, пара и семья: тигрица с тремя детенышами.

Вам также может понравиться этот пост о наблюдении за тиграми в национальном парке Канха, Индия

Лев ( Panthera leo ) Африканский лев (стоковое изображение)

Статус МСОП: Уязвимый

Лев, второй по величине кот в мире, когда-то обитал на большей части Африки, а также в некоторых частях Европы и Азии.Сегодня население ограничено фрагментированными популяциями в Африке к югу от Сахары и одной находящейся под угрозой исчезновения популяции в Индии. Мы уже потеряли берберийского льва, который некогда украшал дебри Египта, Марокко и Алжира.

Традиционно существовали два вида львов: африканский лев и азиатский лев. Но недавний генетический анализ показал, что азиатские львы принадлежат к тому же подвиду, что и северный лев, который также включает находящихся под угрозой исчезновения западноафриканских львов и центральноафриканских львов.Южноафриканский и восточноафриканский лев образуют второй подвид.

Вы можете увидеть львов из Южной и Восточной Африки во время самых классических африканских сафари. Северного льва труднее выследить. Попробовать удачу можно в национальных парках Западной и Центральной Африки. Единственное место, где можно увидеть азиатского льва, — это национальный парк Гир в индийском штате Раджастан.

Я видел львов в национальном парке Крюгера и окружающих его заповедниках. Самым невероятным зрелищем стали редкие белые львы Тимбавати.

Вам также может понравиться этот пост о посещении национального парка Крюгера.

Леопард ( Panthera pardus ) Африканский леопард (стоковое изображение)

Статус МСОП: Уязвимый

Леопард застал экспертов врасплох. Из всех типов больших кошек он имеет самый широкий ареал распространения, происходящий от Африки к югу от Сахары, через Центральную Азию, через Индийский субконтинент до Юго-Восточной Азии. И хотя некоторые подвиды леопарда находятся под угрозой исчезновения, этот вид считался достаточно безопасным.Пока эксперты не осознали, что леопарды потеряли 75 процентов своего исторического ареала, а популяция продолжает сокращаться.

Две горячие точки для леопардов — это часть Африки и Шри-Ланка. В Африке вы, вероятно, встретите леопардов в Национальных парках Крюгера, Серенгети, Чобе, Кратере Нгоронгоро и большинстве других национальных парков на юге и востоке Африки.

Если вы направляетесь в Шри-Ланку, старайтесь избегать национального парка Яла, он стал удручающе переполненным, что отрицательно сказывается на благополучии животных.Вместо этого отправляйтесь на наблюдение за леопардами в национальном парке Уда-Валаве.

Для тех, кто любит приключения, есть возможность отправиться на Дальний Восток России с местным Бохайским туром в поисках находящегося под угрозой исчезновения амурского леопарда — самого редкого вида больших кошек в мире. Хотя их количество медленно увеличивается с примерно 35 человек в 1980-х годах до более 100 человек в 2017 году.

Вам также может понравиться этот пост о том, как отличить ягуара от леопарда.

Ягуар ( Panthera onca ) Молодые братья Ягуары в бразильском Пантанале

Статус МСОП: Под угрозой

Ягуар — самая водолюбивая большая кошка. Это отличный пловец, и его часто можно найти отдыхающим на ветвях деревьев, нависающих над реками. Он также имеет самый сильный укус по отношению к размеру тела среди больших кошек. Его мощные челюсти способны раздробить череп взрослого каймана — его любимой добычи в Пантанале.

Ягуары уникальны среди крупных кошачьих видов тем, что на всей своей территории в 6 миллионов квадратных километров, охватывающей 18 стран, они представляют собой единую непрерывную популяцию. Подвидов ягуаров нет. Таксономически это одна и та же кошка, которая встречается в очень большом ареале.

Это создает уникальные проблемы для сохранения ягуаров. Вместо того, чтобы защищать географически изолированные популяции, ученые теперь работают над защитой соединяющих коридоров среды обитания, которые позволяют ягуарам перемещаться между популяциями и поддерживать поток генов между этими популяциями.

В конце 2018 года Программа развития Организации Объединенных Наций инициировала программу сохранения ягуаров Jaguar 2030, которая направлена ​​на защиту ягуаров на всем их ареале.

Две цитадели ягуаров — это Амазонка и Пантанал в Бразилии. Но Пантанал — гораздо лучшее место для наблюдения за ягуарами, особенно в районе Порто-Хофре — небольшого поселения на берегу реки Куяба

.

Вам также может понравиться этот пост о наблюдении за ягуарами в Пантанале

Снежный барс ( Panthera uncia ) Снежный барс (стоковое изображение)

Статус МСОП: Уязвимый

Снежного барса, самого загадочного из больших кошек, часто называют Призраком гор.В Непале даже есть пословица, что увидеть снежного барса труднее, чем увидеть Бога. Эта неуловимая кошка обитает в одном из самых суровых мест на земле — высокогорных горных хребтах Центральной Азии, и каждая особь обитает на огромных территориях.

Поскольку снежный барс имеет широкий ареал распространения, в 2017 году МСОП понизил его статус с «находящегося под угрозой исчезновения до уязвимого». Однако фонд Snow Leopard Trust оспорил это решение из-за отсутствия научных данных в его поддержку.По оценкам экспертов, в дикой природе осталось от 3920 до 6390 снежных барсов.

Несмотря на непальскую пословицу, снежных барсов регулярно можно увидеть в национальном парке Хемис в Индии. Но это не приключение для слабонервных. Он включает в себя кемпинг при -20 градусов холода и часами сканирование горных долин в поисках неуловимой кошки. Шуба снежного барса из серого меха с черными пятнами позволяет ему настолько органично сливаться с окружающей средой, что вы можете смотреть прямо на него, но не видеть его.

Леопард дымчатый ( Neofelis nebulosa) Туманный леопард (стоковое изображение)

Статус МСОП: Уязвимый

Облачный леопард — самый маленький из видов крупных кошек, а также самый акробатический. Это один из лучших альпинистов во всем семействе диких кошек. Его гибкие голеностопные суставы позволяют ему спускаться по деревьям головой вперед, свешиваться с ветвей задними лапами и хвостом и даже взбираться по горизонтальным ветвям спиной к земле.

И все же скалолазание — не единственный талант затуманенного леопарда.Это единственные большие кошки, которые могут мурлыкать, и у них самые длинные клыки по сравнению с размером тела среди больших кошек. Иногда их называют «современными саблезубами».

Как и всем другим большим кошкам, дымчатому леопарду грозит исчезновение. Предполагается, что общая популяция насчитывает менее 10 000 половозрелых особей с тенденцией к сокращению. Однако из-за своей скрытности дымчатые леопарды не были хорошо изучены и остаются малоизученными. Как и в случае со снежным барсом, популяция может быть меньше нынешней оценки.

Хотя дымчатый леопард простирается от предгорий Гималаев до Юго-Восточной Азии, его невероятно трудно обнаружить в дикой природе. Иногда их замечают во время сафари по дикой природе в Индии.

Леопард зондовый дымчатый ( Neofelis diardi) Зондовый дымчатый леопард. Изображение @ Майк Гордон — Альтернативное приключение Борнео / Дикая природа Азии

Статус МСОП: Уязвимый

До 2016 года дымчатый леопард считался единственным видом.Однако использование методов генетического анализа показало, что дымчатые леопарды с островов Борнео и Суматра на самом деле представляют собой отдельный вид, который отделились от своих собратьев на материке около 1,5 миллиона лет назад.

Известный как зондский дымчатый леопард, островной вид немного меньше и темнее, чем покрытый дымкой леопард на материке. До недавнего времени было почти невозможно увидеть облачного зондского леопарда, как и материкового леопарда.

Но за последние несколько лет лесной заповедник Дерамакот в малазийском штате Сабах на Борнео приобрел репутацию места, где можно увидеть этих неуловимых представителей семейства кошачьих.Конечно, нет никаких гарантий, но если вы хотите увидеть дымчатого леопарда в зондском море, Дерамакот — ваш лучший выбор.

Вам также может понравиться этот пост о поисках туманного леопарда на Борнео

Мелкие виды кошек

Хотя дикие кошки не так известны, как их более крупные кузены, большинство диких кошек — маленькие кошки. Они встречаются на всех континентах, кроме Антарктиды и Австралии, хотя в Австралии есть большая популяция диких кошек, которые являются потомками домашних кошек, прибывших в Австралию с европейскими поселенцами.

Залив кота или линия Пардофелис ​​

Это вторая ветвь, которая расходится с общим предком, линия бухты включает три вида диких кошек, все из которых происходят в регионе Юго-Восточной Азии. Эта линия представляет собой одних из самых редких азиатских диких кошек.

Кошка залива Борнео ( Catopuma badia) Заливный кот. Изображение @ Джим Сандерсон из Википедии Creative Commons

Статус МСОП: Под угрозой исчезновения

Вымирающий кот из залива Борнео — Святой Грааль в мире диких кошек.Встречается только на острове Борнео и так же загадочен для науки, как и впервые описанный в 1874 году. Эти кошки настолько скрытны, что о них практически ничего не известно, и их почти никогда не видели в дикой природе.

Похоже, что, в отличие от дымчатых леопардов, мраморных кошек и леопардовых кошек, которые также встречаются на Борнео, гнедые кошки избегают путешествовать по лесным тропам, что затрудняет определение места установки фотоловушек. И, конечно же, это делает исключительно трудным обнаружение гнедой кошки в дикой природе.Вы просто не знаете, где искать.

Азиатский золотой кот ( Catopuma temminckii) Молодой азиатский золотой кот. Изображение @ Tambako The Jaguar — через Flikr Creative Commons

Статус МСОП:

под угрозой

Еще одна редко встречающаяся кошка, азиатская золотая кошка, имеет широкое, но неоднородное распространение от Индии до Малайзии. Он присутствует на острове Суматра, но не встречается ни на каких других индонезийских островах.

Азиатский золотой кот предпочитает лесную среду обитания и, по-видимому, наиболее активен на рассвете и в сумерках, а также в дневное время.Они достаточно хорошие альпинисты, но проводят большую часть своего времени на земле, где могут сбивать добычу, во много раз превышающую их собственный размер, как молодые детеныши водяных буйволов.

В настоящее время нет надежных мест, где его можно было бы увидеть в дикой природе, но большинство случайных наблюдений произошло в Индонезии.

Мраморный кот ( Pardofelis marmorata) Мраморный кот в лесном заповеднике Дерамакот

Статус МСОП: под угрозой

Мраморный кот — одна из самых красивых маленьких кошек с исключительно длинным хвостом и красивым рисунком шерсти.Этот вид распространен от предгорья Гималаев до Малайзии и на островах Суматра и Борнео. Это отличный альпинист, и считается, что он проводит большую часть своей жизни на деревьях.

Я видел мраморных кошек во время поездок в лесной заповедник Дерамакот на Борнео. Во второй поездке мы смогли наблюдать двух особей на одном дереве, скорее всего, взрослого и полувзрослого котенка.

Вам также может понравиться этот пост о наблюдении за мраморными кошками в лесном заповеднике Дерамакот, Борнео

Происхождение каракала

Третья по возрасту линия, линия каракалов, включает три вида среднего размера, которые в основном встречаются в Африке.

Сервал ( Сервал Leptailurus) Сервал (стоковое изображение)

Статус МСОП: наименьшее беспокойство

Сервал — кошка необычного вида с очень длинными ногами, большими ушами и коротким хвостом. Все эти приспособления необходимы для обнаружения добычи в высокой траве, где она обитает. Широко распространен в Южной Африке, но редко на севере континента. Это невероятное животное из семейства кошачьих способно прыгать до 3,6 м, чтобы приземлиться точно на свою добычу, даже с закрытыми глазами.

Сервал считается необычным, но в большом количестве встречается в заповеднике Нгоронгоро в Танзании. Удивительно, но хорошее место, чтобы увидеть Сервала, находится в небольшом городке Секунда в Южной Африке, где находится крупнейший в мире завод по сжижению угля. Считается, что высокая плотность сервала в такой, казалось бы, негостеприимной среде обитания связана с обилием добычи, такой как крысы vlei, и отсутствием других крупных хищников.

Африканский золотой кот ( Caracal aurata) Африканский золотой кот.Изображение @ Автор: Джон Джеррард Кеулеманс через Википедию Creative Commons

Статус МСОП: Уязвимый

Один из самых редких видов диких кошек и самая редкая дикая кошка в Африке, африканская золотая кошка обитает в тропических лесах Западной и Центральной Африки. Его предпочтение в среде обитания густых тропических лесов делает его особенно трудным для обнаружения в дикой природе.

Было несколько наблюдений в лесной концессии Либонго в Камеруне, где кошки, кажется, довольно часто встречаются на подъездной дороге.

Каракал ( Каракал) Каракал — изображение Adobe Stock

Статус МСОП: наименьшее беспокойство

Каракал — единственный представитель рода каракалов, распространение которого простирается за пределы африканского континента на Ближний Восток, Центральную Азию и Индию. Его название происходит от их угольно-черных ушей, увенчанных пучками — каракал в переводе с турецкого означает «черные уши». Другой акробат, каракал, способен прыгнуть на 3 метра в воздух и одним взмахом убить нескольких птиц.

Каракалы скрытны и трудны для наблюдения, но их часто можно увидеть в парках и заповедниках Южной Африки (Национальный парк Кгалагади, Национальный парк Западного побережья, Мозаичные фермы). Мне посчастливилось увидеть семью каракалов в национальном парке Рантхамбор в Индии, где их не часто можно увидеть.

Вам также может понравиться этот пост о наблюдении за каракалами в национальном парке Рантхамбор, Индия

Происхождение Оцелота или Леопарда

Это самая разнообразная линия диких кошек.Он содержит восемь маленьких пятнистых кошек, все латиноамериканского происхождения. Эта линия отличается от всех остальных тем, что у ее членов 36 хромосом, а не 38!

Оцелот ( Leopardus pardalis) Самка оцелота в бразильском Пантанале, Фазенда Сан-Франциско

Статус МСОП: наименьшее беспокойство

Оцелот встречается в Южной Америке, Центральной Америке, Мексике и Южном Техасе. Это, вероятно, самый распространенный или, скорее, наименее редкий из диких кошек Южной Америки.

Самая высокая плотность оцелотов в мире находится на острове Барро-Колорадо в Панаме. Шоссе Транспантанейра в северном Пантанале Бразилии — также хорошее место для поиска пятнистых охотников. Но лучше всего их увидеть — это ферма Сан-Франциско на юге Пантанала. Я видел трех оцелотов за одну ночную поездку; все три наблюдения были очень расслабленными и с очень близкого расстояния.

Вам также может понравиться этот пост о поиске оцелотов в Пантанале

Маргай ( Leopardus wiedii) Маргай (стоковое изображение)

Статус МСОП: Под угрозой

Внешне похожий на более крупного оцелота, маргай — гораздо более искусный альпинист.В отличие от оцелота, маргай большую часть жизни проводит на деревьях. Это один из трех видов диких кошек с гибким голеностопным суставом, который позволяет кошке спускаться по деревьям головой вперед (два других — дымчатый леопард и мраморный кот).

Маргаи умеют охотиться исключительно на деревьях. Было замечено, что они имитируют тревожные крики маленьких пестрых тамаринов, чтобы устроить на них засаду.

Кошек, живущих на деревьях, обычно труднее обнаружить, чем их наземных сородичей.По сообщениям, отель Wildsumaco Lodge в Эквадоре — хорошее место для поиска Маргая.

Colocolo ( Leopardus colocolo) Colocolo. Изображение @ Márcio Motta через Flikr Creative Commons

Статус МСОП:

под угрозой

Colocolo включает небольших диких кошек, которые ранее считались тремя разными видами: colocolo ( L. colocolo ), кошка Pantanal ( L. braccatus ) и кошка пампас ( L. pajeros) . Недавний пересмотр таксономии семейства Felidae Группой специалистов по кошкам признал колоколу или пампасскую кошку единственным видом, который обитает на большей части территории Аргентины и Уругвая, включая Боливию, Парагвай, Бразилию и Эквадор.

Я скучал по колоколо в Фазенда Сан-Франциско в Южном Пантанале в Бразилии, где их видят примерно раз в неделю.

Северная Онцилла ( Leopardus tigrinus) Oncilla (Adobe Stock)

Статус МСОП: уязвимый

Онцилла похожа на оцелота и маргая, но меньше по размеру. Недавно онциллы разделили на два отдельных вида: северные онциллы и южные онциллы. Северная онцилла встречается в Центральной Америке, Венесуэле, Гайане и на северо-востоке Бразилии.

Хорошее место для поиска — Bellavista Lodge недалеко от Кито в Эквадоре. Их также иногда можно увидеть в бразильском Пантанале.

Южная онцилла ( Leopardus guttulus)

Статус МСОП: уязвимый

Южная онцилла встречается в центральной и южной частях Бразилии, Уругвае, Парагвае и на севере Аргентины.

Гуина ( Leopardus guigna) Гуина на острове Чилоэ, Чили (экспедиции на Дальний Юг)

Статус МСОП: Уязвимый

Гуина, также известная как Кодкод, является самым маленьким видом диких кошек в Южной Америке.Он встречается в основном на юге и в центре Чили, а часть его ареала простирается до прилегающих районов Аргентины. Это ловкий альпинист, хотя предпочитает наземную охоту, ловя в основном мелких млекопитающих, птиц, ящериц и насекомых.

Типичная шерсть кодкода

— от коричневато-желтой до серо-коричневой с темными пятнами, но меланистические (черные) морфы также довольно распространены.

Хорошим местом для поиска гиньи в дикой природе, в том числе необычных меланистов, является остров Чилоэ в Чили.

Кот Жоффруа ( Leopardus geoffroyi) Кот Черного Джеффруа в национальном парке Эль-Пальмар, Аргентина

Статус МСОП: наименьшее беспокойство

По внешнему виду похож на Гуину, но крупнее, кошка Жоффруа имеет более широкое распространение от Южной Боливии до Магелланова пролива. Это единственный вид диких кошек, которые имеют привычку стоять прямо, используя свой хвост для равновесия при сканировании своего окружения.

Из-за того, что он предпочитает плотную среду обитания, кошку Жоффруа трудно обнаружить.Как и у гины, у Жоффруа шерсть обычно желтовато-коричневая с черными пятнами, хотя черные морфы также не редкость. Хорошее место для его поиска — национальный парк Эль-Пальмар в Аргентине. Я посетил Эль-Пальмар в необычно дождливую погоду в начале сентября, и мне потребовалось три ночи, чтобы разглядеть одну-единственную кошку, симпатичного черного морфа.

Вам также может понравиться этот пост о поиске черного кота Джеффруа в Эль-Пальмаре, Аргентина

Андская кошка ( Leopardus jacobita) Андский горный кот (Хуан Реппуччи — Альянс Андских кошек)

Статус МСОП: Под угрозой исчезновения

Одна из самых редких кошек в мире, андская кошка, находящаяся под угрозой исчезновения, встречается только на больших возвышенностях в Андах на юге Аргентины, Чили, Боливии и Перу.Как и его более крупный высокогорный родственник, снежный барс, горный кот Анд является одним из самых редко встречаемых диких кошек в мире. Он предпочитает крутые, засушливые, скалистые местности с редкой растительностью, где охотится на горные вискачи.

Национальный парк Лаука и национальный памятник Салар-де-Сурире в Чили были предложены в качестве хороших районов для поиска андской кошки.

Линия рыси

Линия рыси включает четыре отдельных вида, которые очень похожи по внешнему виду.У всех четырех видов короткие хвосты и пучковые уши.

Канадская рысь ( Lynx canadensis) Канадская рысь (изображение Adobe Stock)

Статус МСОП: наименьшее беспокойство

Канадская рысь — самый северный представитель рода рыси, обитающая на Аляске, в Канаде и на севере США. Его самая отличительная особенность — массивные лапы, покрытые густым мехом. Большие лапы служат для создания снегоступов, позволяя канадской рыси путешествовать по заснеженным ландшафтам, не проваливаясь в снег.

Озеро Верхнее в Миннесоте — хорошее место, чтобы увидеть канадскую рысь.

Иберийская рысь ( Lynx pardinus) Иберийская рысь (стоковое изображение)

Статус МСОП: Под угрозой исчезновения

Мир был опасно близок к тому, чтобы потерять иберийскую рысь. К 2002 году на изолированных участках средиземноморских зарослей в Испании оставалось меньше сотни кошек. К тому времени, когда ученые осознали, насколько опасна ситуация с рысью, было почти слишком поздно спасти ее.К счастью, иберийская рысь хорошо откликнулась на разведение в неволе. С 2010 года более 170 рысей были повторно введены в дикую природу в рамках проекта «Спасение рыси».

С тех пор популяция увеличилась до чуть более 400 кошек, а статус иберийской рыси по МСОП был понижен с «Критически исчезающие» до «находящихся под угрозой исчезновения». Сегодня иберийская рысь встречается в нескольких районах на юге Испании, и лучшим местом для ее наблюдения является национальный парк Сьерра-де-Андухар. Многие туристические агентства по наблюдению за дикой природой предлагают специализированные туры по иберийской рыси.

Евразийская рысь ( Lynx lynx) Евразийская рысь (стоковое изображение)

Статус МСОП: наименьшее беспокойство

Евразийская рысь — самый крупный представитель рода рыси и имеет самое широкое распространение. Распространяется по Сибири, Азии и Восточной Европе. Евразийская рысь не находится под угрозой, но ее сложно обнаружить в дикой природе.

Нет конкретных надежных мест, где можно было бы увидеть евразийских рысей в дикой природе, но иногда их можно увидеть во время походов снежных барсов в национальный парк Хемис в Индии.

Bobcat ( Lynx rufus) Bobcat (стоковое изображение)

Статус МСОП: наименьшая проблема

По внешнему виду похож на канадскую рысь, Bobcat обитает от юга Канады до центральной Мексики. Он меньше канадской рыси и вырастает примерно в два раза больше домашней кошки. Название кошки происходит от ее короткого (или «подстриженного») хвоста. Как и все рыси, рыси — специалист по кроликам, однако она также может ловить насекомых, кур и других птиц, грызунов и даже оленей.

Вообще, рыси — обычный вид, и хорошее место, чтобы увидеть их, — это природный приморский берег Пойнт-Рейес недалеко от Сан-Франциско.

Пума Lineage

Линия Puma включает в себя самую необычную смесь кошачьих: одну типичную маленькую кошку и двух больших маленьких кошек.

Пума ( Пума concolor) Пума (изображение Adobe Stock)

Статус МСОП: наименьшее беспокойство

Хотя Пума — довольно крупная кошка, она не принадлежит к семейству больших кошек, и, следовательно, это маленькая кошка.Пума, которую часто называют пумой или горным львом, обитает в Южной Америке, Мексике, Соединенных Штатах и ​​некоторых частях южной Канады.

Лучшее место, где можно увидеть пум, — национальный парк Торрес-дель-Пайне в Чили. Тем не менее, я видел пуму с двумя детенышами-подростками в метко названной Долине Пумы в Национальном парке Корковадо в Коста-Рике.

Вам также может понравиться этот пост о том, как найти пум в Корковадо, Коста-Рика

Гепард ( Acinonyx jubatus) Молодые гепарды (стоковое изображение)

Статус МСОП: Уязвимый

Гепард — самый быстрый вид диких кошек и самое быстрое животное на Земле.Он может разогнаться с 0 до 96 км / ч всего за три секунды. Он не только быстр, но и довольно проворен на большой скорости и может делать резкие повороты в погоне за добычей. Гепард также хорошо приспособлен к жизни в условиях африканской жары — пить его нужно всего лишь раз в четыре дня.

Гепард встречается в Южной, Северной и Восточной Африке, а также в нескольких местах в Иране. Иранская популяция, известная как азиатский или персидский гепард, занесена в список находящихся под угрозой исчезновения: на обширном плато площадью 140 000 км. 2 осталось менее 50 особей.

Африканского гепарда довольно легко увидеть на сафари в Южной и Восточной Африке. Я видел мать с маленьким детенышем на убой в национальном парке Крюгера в Южной Африке.

Вам также может понравиться этот пост о обнаружении гепардов в Национальном парке Крюгера

Ягуарунди ( Herpailurus yagouaroundi) Серый ягуарунди и морфы каштанового цвета (изображение Adobe)

Статус МСОП: вызывает наименьшее беспокойство

Ягуарунди с короткими ногами и длинным телом — одна из самых необычных кошек.Его без пятен окраска похожа на пуму, это ближайший родственник, но отличается от всех других южноамериканских кошек. Встречается на юге Северной Америки и в Южной Америке.

Хотя ягуарунди не считается угрожаемым видом, его нелегко обнаружить в дикой природе. Большинство наблюдений этого вида происходит в Южной Америке, но, как правило, случайно. Большинство наблюдений происходит при дневном свете.

Леопардовый кот или линия Prionailurus

Это еще одна линия, в которой содержится много (шесть) маленьких диких кошек.Все виды этой линии имеют азиатское распространение.

Кот Палласа ( Otocolobus manul) Кот Палласа (стоковое изображение)

Статус МСОП: под угрозой

Также известная как Манул, кошка Палласа имеет самый длинный и густой мех среди всех видов кошек. Причина, по которой ему нужна такая роскошная шуба, заключается в том, что он предпочитает продуваемые ветрами ландшафты скалистых склонов Центральной Азии. Каменистая среда обитания обеспечивает кошке убежище в пещерах, расщелинах скал или даже в норах сурков.Любимая добыча паллады — пищухи и полевки, хотя иногда они ловят и птиц.

Кошки Палласа не умеют бегать. Вместо этого они полагаются на свою способность оставаться незамеченными. При потревожении он часто замерзал и становился практически невидимым на сером каменистом ландшафте.

Одно из лучших мест, где можно увидеть кошку Палласа, находится на пастбищах Руоергай на Тибетском плато на северной оконечности китайской провинции Сычуань. За пять дней я увидел на лугах как минимум трех разных особей.

Вам также может понравиться этот пост о том, как вы заметили кошку Палласа на Тибетском плато

Ржаво-пятнистый кот ( Prionailurus rubiginosus) Ржаво-пятнистая кошка (стоковое изображение)

Статус МСОП: Под угрозой

Самая маленькая дикая кошка в мире, ржаво-пятнистая кошка, родом из лиственных лесов Индии и Шри-Ланки. Он вырастает до 1,6 кг в весе и 48 сантиметров в длину. Но недостаток в росте компенсируется смелостью.Он одинаково хорошо чувствует себя как на деревьях, так и на земле, где ловит свою добычу (в основном грызунов и мелких птиц) быстрыми, стремительными движениями.

Национальный парк Уилпатту на Шри-Ланке — одно из лучших мест, где можно увидеть ржавых пятнистых кошек в дикой природе.

Кошка с плоской головой ( Prionailurus planiceps) Плоскоголовый кот в зоопарке Кхао Кхео, Таиланд

Статус МСОП: Под угрозой исчезновения

Плоскоголовый кот — это маленькая кошка, находящаяся под угрозой исчезновения, которая обитает на Тайско-Малайском полуострове и на островах Борнео и Суматра.Это необычное животное из семейства кошачьих ведет полуводный образ жизни, живя на берегах рек и охотясь на водных позвоночных. Он отличный пловец и прекрасно приспособлен к охоте в воде. Его когти не убираются полностью, чтобы лучше держаться на скользких берегах реки. Его лапы полуперепончатые, что удобно для перехода в воду. А его длинные и острые клыки — отличные помощники для захвата скользкой водной добычи.

Этим необычным кошкам угрожает все большее разрушение местообитаний речных лесов, поскольку все больше и больше земель превращается в плантации масличных пальм, поселения людей и сельское хозяйство.

Единственное надежное место, чтобы увидеть это — низовья реки Кинабатанган на Борнео, недалеко от деревни Сукау. Я видел одного человека после четырех ночей поисков.

Вам также может понравиться этот пост о том, как найти Плоскоголовый кот на Борнео

Кошка-рыболов ( Prionailurus viverrinus) Кошка-рыболов (стоковое изображение)

Статус МСОП: Под угрозой исчезновения

Необычные для кошек кошки-рыболовы не только не боятся воды, но и зависят от нее в еде, как и кошка с плоской головой.Оба вида охотятся на рыбу и мелких водных позвоночных.

Кошка-рыболов имеет более широкий ареал распространения в Южной и Юго-Восточной Азии. Лучшее место для поиска кошек-рыбаков — на Шри-Ланке, в окрестностях Сигирии и на окраине национального парка Яла (сам парк недоступен после наступления темноты).

Материковый леопардовый кот ( Prionailurus bengalensis)

Статус МСОП: наименьшее беспокойство

Леопардовая кошка — самая распространенная из всех азиатских мелких кошек, обитающая в Южной, Юго-Восточной и Восточной Азии.Этот вид достаточно устойчив к вмешательству человека и часто встречается в сельской местности и даже среди плантаций масличных пальм.

Морской леопардовый кот ( Prionailurus javanensis) Зондский леопардовый кот в лесном заповеднике Дерамакот

В 2017 году морская леопардовая кошка, обитающая на островах Борнео и Суматра, была отделена от материковой леопардовой кошки на основе генетического анализа. Это обычное явление на Борнео, и я видел его как в долине Дамнум, так и в лесном заповеднике Дерамакот.

Вам также может понравиться этот пост о поисках зондских леопардовых кошек на Борнео

Felis Lineage

Последняя линия, отошедшая от общего предка, и, следовательно, самая молодая ветвь. Все шесть маленьких диких кошек этой линии тесно связаны между собой и распространены в Африке и Евразии.

Кот в джунглях ( Felis chaus) Джунгли кошки (стоковое изображение)

Статус МСОП: наименьшие опасения

Кот из джунглей, также известный как болотный кот — кошка среднего размера, обитающая на Ближнем Востоке, в Южной и Юго-Восточной Азии и на юге Китая.Кошки из джунглей обычно ведут дневную охоту. Мое наблюдение за кошкой из джунглей также произошло днем ​​в заповеднике тигров Канха в Индии.

Вам также может понравиться этот пост о посещении заповедника тигров Канха

Черноногая кошка (стоковое изображение)

Статус МСОП: Уязвимый

Самая маленькая дикая кошка в Африке, черноногая кошка — вторая самая маленькая дикая кошка в мире после кошки с ржавыми пятнами. Это отличный охотник с потрясающим аппетитом — он может съесть до 3000 грызунов в год.По прозвищу муравейник-тигр, он живет в заброшенных термитниках и бродит по окружающей саванне в поисках грызунов.

Черноногая кошка имеет узкий ареал распространения в южной части Южной Африки. Маррик-Фарм-Сафари в Южной Африке — лучшее место для поиска этого вида.

Песчаный кот ( Felis margarita ) Песчаный кот (изображение Adobe Stock)

Статус МСОП: наименьшее беспокойство

Настоящий обитатель пустыни, песочный кот обитает в пустынях Северной Африки, Ближнего Востока и Центральной Азии.Хотя этот вид не находится под угрозой исчезновения, его не так просто увидеть в дикой природе.

У песочного кота невероятно плотная шерсть, которая защищает его от холода пустынных ночей. Пряди густого черного меха на подошвах ног защищают его от противоположной крайности — раскаленного песка.

Песчаные кошки чаще всего встречаются из Западной Сахары и национального парка Джебил на юге Туниса.

Китайский горный кот ( Felis bieti) Китайская горная кошка исчезает в темноте на Тибетском плато

Статус МСОП: уязвимый

Один из наименее известных и наиболее редко встречаемых диких кошек, китайский горный кот даже не был сфотографирован в дикой природе около десяти лет назад.Имеет узкое распространение в Западном Китае.

Я видел китайскую горную кошку на лугах Руоергай на Тибетском плато. За четыре ночи на плато я видел кошек трижды, так что это определенно хорошее место.

Вам также может понравиться этот пост о поисках китайских горных кошек на Тибетском плато

Африканская и азиатская дикая кошка ( Felis lybica) Африканская дикая кошка (Adobe stock image)

После некоторых недавних таксономических изменений виды дикой кошки были разделены на африканскую и азиатскую дикую кошку и европейскую дикую кошку.Я видел африканскую дикую кошку в заповеднике Капама, недалеко от национального парка Крюгера в Южной Африке. Национальный парк Кафуэ в Замбии был предложен как хорошее место для диких кошек.

Вам также может понравиться этот пост о поиске африканских диких кошек в заповеднике Капама, Южная Африка

Европейская лесная кошка ( Felis silvestris) Европейская лесная кошка (изображение Adobe Stock)

Статус МСОП: вызывает наименьшие опасения

Европейская дикая кошка имеет неоднородное распространение в лесах Западной, Южной, Центральной и Восточной Европы вплоть до Кавказских гор.Хорошее место для поиска европейской дикой кошки — это Кордильера Кантабрика на севере Испании, в районе Бока-де-Уэргано.

Сколько видов диких кошек находится под угрозой исчезновения?

Дикие кошки сталкиваются с рядом антропогенных угроз, таких как потеря и фрагментация среды обитания, потеря видов-жертв и преследование людьми в результате реальных или предполагаемых рисков, которые кошки представляют для средств к существованию людей. В результате 25 видов диких кошек в настоящее время находятся под угрозой исчезновения.

Пять видов занесены в Красную книгу МСОП, находящуюся под угрозой исчезновения: тигр, бухта Борнео, андская кошка, плоскоголовая кошка и иберийская рысь.

Еще тринадцать видов диких кошек перечислены как уязвимые: лев, леопард, снежный барс, дымчатый леопард, дымчатый леопард Sunda, африканская золотая кошка, северная онцилла, южная онцилла, гина, гепард, рыбацкая кошка, черноногая кошка и китайская горная кошка. .

И семь видов диких кошек перечислены как находящиеся под угрозой исчезновения: ягуар, азиатский золотой кот, мраморный кот, маргай, колокол, кот Палласа и кот с ржавыми пятнами.

Вы видели диких кошек в своих путешествиях? Я хотел бы прочитать о ваших наблюдениях в комментариях

Подробнее о диких кошках


фактов об амурском леопарде | Альянс за сохранение диких кошек

Среда обитания: Амурские леопарды обитают в лесах с умеренным климатом на Дальнем Востоке России, переживая суровые зимы с очень холодными и глубокими снегами, а также жаркое лето.

Местонахождение: Они обитают на юго-западе Приморья на Дальнем Востоке России и вдоль российской границы с провинциями Хэйлунцзян и Цзилинь на северо-востоке Китая.Возможно, несколько леопардов обитают и в Северной Корее, но пока нам не удалось обследовать этот район.

Амурский леопард — самый северный из подвидов леопарда. Его исторический ареал простирался на северо-восток («маньчжурский») Китай, южную часть Приморского края в России и на Корейский полуостров. Этот диапазон резко сократился в течение 20 века, в первую очередь из-за потери среды обитания и охоты.

На рубеже 20-го века леопард все еще встречался на большей части юга Приморского края.Первая достоверная оценка численности леопарда в России была сделана Дмитрием Пикуновым и Владимиром Абрамовым зимой 1972-1973 годов. К этому времени популяция в Приморье уже сократилась с одной непрерывной популяции на три изолированные, и, по оценкам, в России осталось от 38 до 46 амурских леопардов, многие из которых зависели от среды обитания по обе стороны российско-китайской границы. Исследование 1985 г. показало, что леопарды исчезли в районе к юго-западу от озера Ханка и на юге Сихотэ-Алиня.Численность леопарда на юго-западе Приморья осталась примерно такой же, как и в 1972 г. — от 25 до 30 особей. Более поздний подсчет, проведенный зимой 1990-1991 гг., Показал, что численность популяции на юго-западе Приморья стабильна и составляет от 30 до 36 особей с учетом мигрантов в Китай и из Китая. Самые последние результаты мониторинга популяции в 2011 году показывают, что в настоящее время насчитывается около 40 особей, а исследования, проведенные в Китае в 2012 году, показывают, что в этом регионе обитает менее 20 леопардов.

Амурский леопард, вероятно, вымер в дикой природе в Южной Корее в конце 1960-х годов, хотя некоторые недавние неподтвержденные сообщения предполагают, что несколько леопардов могут остаться в демилитаризованной зоне между Северной и Южной Кореей и вокруг нее.Вероятно, леопарды все еще обитают в суровом северном регионе Северной Кореи недалеко от границы с Китаем, и также вероятно, что животные из юго-западного Приморья в России иногда пересекают границу с Северной Кореей, но достоверной информации нет.

Конкуренция: Хотя в других регионах кажется, что леопарды не преуспевают в районах, где они делят территорию с тиграми, в России это не подтвердилось. Исследования показали, что рост численности тигров в юго-западной части Приморья не оказал негативного воздействия на популяцию леопарда.

ADW: Felis silvestris: ИНФОРМАЦИЯ

Географический диапазон

Дикие кошки обитают в континентальной Европе, Юго-Западной Азии и в африканских саваннах. В настоящее время считается, что Felis silvestris состоит из трех отдельных групп (или подвидов): F. silvestris lybica, африканские дикие кошки, F. silvestris silvestris, европейские дикие кошки, и F. silvestris ornata, азиатские дикие кошки. Африканские дикие кошки встречаются в подходящей среде обитания по всей Африке и на Аравийском полуострове.Европейские дикие кошки встречаются по всей Европе и на западе России, за исключением большей части Британских островов (они встречаются в Шотландии) и Скандинавских стран. Азиатские дикие кошки обитают на Ближнем Востоке, юге России, западе Китая и Индии. Некоторые авторитетные источники признают F. s. silvestris как вид, отличный от F. s. lybica и F. s. орната. Считается, что домашние кошки произошли от африканских диких кошек и встречаются практически во всем мире среди людей. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c)

Среда обитания

Африканские дикие кошки встречаются по всей Африке в самых разных средах обитания.Их нет только в тропических лесах. В пустынных регионах они ограничены горными районами и водными путями.

Азиатские дикие кошки обитают в основном в кустарниковой пустыне, но их можно встретить в самых разных средах обитания. Они отсутствуют на альпийских и степных лугах, и северная граница их распространения может определяться высотой снежного покрова. Их можно найти на высоте до 3000 м в горах и, как правило, у источников воды.

европейских диких кошек обитают в основном в лиственных лесах.Они также известны из хвойных лесов, но могут быть маргинальными местообитаниями. Они ограничены в своем северном распространении высотой снежного покрова и обычно встречаются в районах с малой численностью населения. Европейские дикие кошки не могут сохраняться в районах, где глубина снежного покрова зимой превышает 20 см, в течение более 100 дней. Они известны по ландшафтам с преобладанием человека, где выпас является доминирующей формой сельского хозяйства и, следовательно, землепользование не является интенсивным. Они также известны из кустарников, прибрежных мест обитания и прибрежных районов.

Домашние кошки встречаются во многих средах обитания из-за их связи с людьми. Лучше всего они растут в районах, где зимы не очень холодные. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c)

  • Диапазон превышения
    3000 (высокий) м
    9842,52 (высота) футов

Физическое описание

Вес диких кошек колеблется от 2 до 2.От 7 до 4 кг у самок (F. s. Silvestris в среднем 3,5 кг, F. s. Notatus в среднем 2,7 кг, F. s. Libyca в среднем 4 кг) до в среднем от 4 до 5 кг у самцов (F. s. Silvestris в среднем 5 кг, F. s. notatus в среднем 4 кг, F. s. libyca в среднем 5 кг), хотя вес отдельных кошек существенно меняется в течение года. Домашние кошки похожи по размеру, но могут стать намного тяжелее из-за переедания. Длина тела обычно составляет от 500 до 750 мм, а длина хвоста — от 210 до 350 мм.

Дикие кошки обычно серо-коричневые, с пушистым хвостом и хорошо выраженным рисунком из черных полос по всему телу.Их мех короткий и мягкий. Их окраска похожа на окраску полосатой домашней кошки, поэтому их трудно увидеть в лесной среде обитания. У европейских диких кошек (F. s. Silvestris) густой зимний мех, из-за чего они иногда кажутся крупнее других диких кошек. Азиатские дикие кошки (F. s. Notatus), как правило, имеют фоновый цвет шерсти, более красноватый или желтый, с вышележащим рисунком из темных пятен, которые иногда переходят в полосы. Африканских диких кошек (F. s. Libyca) трудно отличить от домашних кошек.Их мех более светлый и менее густой, чем у европейских диких кошек, а их хвосты тонкие и заостренные. Тем не менее, африканские дикие кошки (F. s. Libyca) охватывают большой географический ареал, а окраска и плотность шерсти варьируются в зависимости от широты, от песочно-желтого до серого и коричневого с более темными полосами и пятнами. У них есть характерный красноватый оттенок шерсти на затылке ушей.

Домашние кошки были выбраны людьми для отображения широкого спектра форм и цветов тела, от голых до длинношерстных персов и бесхвостых мэнских кошек до очень крупных кошек мейн-кун.Цвета варьируются от черного до белого, а также встречаются смеси красного, желтого и коричневого.

У диких кошек по пять пальцев на каждой из передних лап, но только по четыре пальца на каждой задней лапе. У кошек есть когти, которые можно втягивать обратно в ножны, когда они не используются, что делает их довольно острыми. Зубы кошек очень приспособлены к хищничеству. Клыки отлично подходят для нанесения ударов и удержания добычи, так как верхние из них направлены почти прямо вниз, а нижние изогнуты. Моляры специализируются на резке.Поскольку у диких кошек нет зубов для раздавливания, они едят пищу, разрезая ее. Язык покрыт крошечными изогнутыми выступами, называемыми сосочками. Они используются для ухода за телом и слизывания мяса с костей. Хотя у кошек есть бакенбарды, у них нет ресниц. У них есть полное внутреннее веко, или мигательная перепонка, которая защищает глаз от повреждений и высыхания. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

  • Диапазон масс
    3.От 5 до 5 кг
    от 7,71 до 11,01 фунта

Репродукция

Когда у самки дикой кошки начинается течка, местные самцы собираются рядом с самкой и соревнуются за доступ к ней. Самцы визжат, воют, выставляют напоказ и дерутся. Суки будут вязать с несколькими кобелями, и возможно отцовство в одном помете.

Размножение диких кошек происходит в разное время года в зависимости от местного климата.У европейских диких кошек (F. s. Silvestris) размножение происходит в конце зимы (с января по март), а рождение происходит весной, обычно в мае. Размножение было зарегистрировано почти круглый год у азиатских диких кошек (F. s. Notatus), а у африканских диких кошек (F. s. Libyca) размножение регистрировалось с сентября по март. Самки беременны от 56 до 68 дней и рожают от 1 до 8 детенышей, в среднем 3,4, в защищенной норе, часто под камнями или в густой растительности. Самки становятся половозрелыми в возрасте от 10 до 11 месяцев, а самцы — от 9 до 22 месяцев.

Домашние кошки могут размножаться гораздо чаще, до 3 раз в год, поскольку обычно они не ограничены питанием или климатом. Средний размер помета у домашних кошек — от 4 до 6. Срок беременности составляет в среднем 65 дней. Домашние котята отлучены от груди примерно в 8 недель и становятся самостоятельными примерно в 6 месяцев. Самки становятся половозрелыми уже в 6 месяцев. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

  • Период размножения
    европейских диких кошек рожают один помет каждый год.Иногда они могут родить второй помет, если первый был потерян в начале сезона.
  • Сезон размножения
    Роды обычно происходят в мае.
  • Диапазон количества потомков
    с 1 по 8
  • Среднее количество потомков
    3.63
  • Среднее количество потомков
    3,7
    Возраст
  • Период беременности
    от 60 до 70 дней
  • Средний срок беременности
    66 дней
  • Диапазон отъема от груди
    от 42 до 84 дней
  • Диапазон возраста половой или репродуктивной зрелости (женщины)
    9.От 0 до 12,0 месяцев
  • Диапазон возраста половой или репродуктивной зрелости (самцы)
    от 9,0 до 12,0 месяцев

Молодые рождаются с закрытыми глазами и не могут ходить. Мать кормит и заботится о них в берлоге в течение 4–12 недель. Их глаза открываются в 10 дней, и они кормят грудью около 30 дней.Они остаются со своей матерью, осваивая навыки охоты и выживания от 4 до 10 месяцев, обычно около 5 месяцев. После этого они изгнаны из ареала своей матери и должны стать независимыми. Самцы не помогают ухаживать за котятами. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

Срок службы / Долговечность

европейских диких кошек живут до 15 лет в дикой природе, хотя большинство из них умирают до конца своего первого года жизни.Домашние кошки могут жить в неволе дольше: в исключительных случаях 30 лет и дольше. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996c; Новак, 1997)

Поведение

Дикие кошки и их домашние сородичи обычно активны ночью, в сумерках и на рассвете, хотя они также активны днем, особенно в районах, где человека мало беспокоит. В частности, азиатские дикие кошки часто активны в течение дня. Дикие кошки часто путешествуют ночью в поисках добычи.Одна европейская дикая кошка проехала 10 км за ночь.

Дикие кошки — в основном одиночные животные, их домашние аналоги более общительны и могут встречаться небольшими семейными группами. Одичавшие домашние кошки также обычно живут поодиночке, но могут образовывать небольшие колонии в местах скопления источников пищи, таких как свалки. В необузданных популяциях домашних кошек кошки обычно остаются в районе своего рождения, в то время как самцы покидают место своего рождения и пытаются обосноваться в другом месте.В местах скопления вольных домашних кошек формируется своего рода иерархия. Новички должны пройти серию боев с постоянными животными, прежде чем их положение в иерархии будет определено. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

Домашний диапазон

У самцов диких кошек есть домашние ареалы, которые частично совпадают с ареалами нескольких самок. Был зарегистрирован самец африканской дикой кошки с домашним диапазоном 4.3 квадратных километра.

Домашние ареалы домашних кошек широко варьируются в зависимости от концентрации ресурсов и плотности сдержанных и диких кошек. (Группа специалистов МСОП по кошкам, 1996c)

Коммуникация и восприятие

Самцы диких кошек помечают территорию, распыляя сильную мочу на предметы по всему дому. Самки также общаются, когда они готовы к размножению, с помощью испускаемых ими запахов, которые очень привлекательны для самцов.У кошек есть ароматические железы на лбу, вокруг рта и у основания хвоста. Кошка трется этими железами о предметы, чтобы пометить их своим запахом.

Дикие кошки общаются с помощью визуальных сигналов, таких как вздыбление шерсти на спине, движение хвостом и мимика. У них также есть множество звуков, которые передают разные намерения, включая агрессивное шипение и вой, ласковое мурлыканье и писк, используемый для того, чтобы замолчать котят.

У диких кошек хорошо развито обоняние и слух. Уши кошки могут быстро вращаться, чтобы определить источник определенного звука, и способны реагировать на частоты до 25 000 колебаний в секунду. Благодаря этой способности кошки могут слышать даже ультразвуковые шумы, издаваемые мелкими грызунами. Иногда это позволяет им находить и ловить добычу, не видя ее. Их зрение хорошее, но, вероятно, не лучше, чем у людей. Цветовой диапазон кошек меньше человеческого.Глаза кошек расположены на передней части головы. Хотя это позволяет им иметь отличное восприятие глубины, что является полезным инструментом в охоте, кошки не могут видеть прямо под носом. Они также могут видеть даже крошечные движения, помогая им находить добычу. Их глаза приспособлены для зрения при тусклом свете для охоты сразу после сумерек или перед рассветом.

Другой примечательный способ ощущения у кошек — это усы или вибриссы. Усы — это особые волоски, которые используются в качестве очень чувствительных органов прикосновения.Кошка использует свои усы, чтобы определить, могут ли их тела пройти через небольшие отверстия, такие как маленькие трубы, и другие различные предметы. Они также используют их для обнаружения движения добычи.

Привычки к еде

Как и в случае с большинством мелких видов кошек, диета диких или домашних кошек в основном состоит из мелких грызунов, таких как мыши и крысы. Кролики могут быть предпочтительной добычей в некоторых районах и, по-видимому, являются основной добычей европейских диких кошек (F. s. Silvestris).Другие объекты добычи включают птиц, молодых копытных, рептилий, земноводных, яйца, а также крупных насекомых и паукообразных. Европейские дикие кошки (F. s. Silvestris) были зарегистрированы поедающими падаль, но, как сообщается, это редко встречается у африканских и азиатских диких кошек (F. s. Libyca и F. s. Notatus). Кеширование пищи было зарегистрировано у европейских диких кошек (F. s. Silvestris). Грызуны, на которых охотятся азиатские дикие кошки (F. s. Notatus), включают тушканчиков, песчанок, полевок и мышей. Иногда кошки едят траву, чтобы очистить желудок от неперевариваемой пищи, такой как кости, мех и перья.Дикие кошки способны подчинять себе добычу почти такого же размера, как они сами, и стараются избегать добычи с колючками, панцирями или неприятным запахом. Самки диких кошек могут научить своих детенышей ловить добычу, принося им раненых животных для тренировки. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

  • птицы
  • млекопитающие
  • рептилии
  • падаль
  • насекомые
  • наземные членистоногие, не являющиеся насекомыми

Хищничество

На большинство диких кошек охотятся как молодые кошки более крупные хищники, такие как лисы, волки, другие кошки и крупные хищные птицы, такие как совы и ястребы.

Дикие кошки свирепы, когда им угрожают, и могут защитить себя от животных, которые крупнее их самих. Также они скрытны и подвижны. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

Роли в экосистеме

Европейские дикие кошки играют важную роль в борьбе с популяциями грызунов и других мелких млекопитающих. Действительно, именно эта характеристика, вероятно, привела к одомашниванию европейских диких кошек.Домашние кошки по-прежнему содержатся в основном во всем мире для борьбы с популяциями грызунов в городских и сельскохозяйственных районах.

Экономическое значение для людей: положительный результат

Домашние кошки высоко ценятся как домашние и рабочие животные во всем мире. Они помогают контролировать популяции грызунов и использовались в качестве животных в поведенческих и физиологических исследованиях.

Дикие кошки — важные представители природных экосистем.Они играют важную роль в контроле за популяциями мелких млекопитающих во всем их ареале. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

Экономическое значение для людей: отрицательно

Домашние кошки являются переносчиками ряда болезней, которые могут передаваться человеку, включая бешенство, лихорадку кошачьих царапин и несколько паразитарных инфекций. Домашние кошки также ответственны за сокращение популяции и исчезновение многих видов птиц и млекопитающих, особенно тех, которые обитают на островах.Усилия по контролю за популяциями домашних кошек, которые были завезены на острова, обошлись этим правительствам в многие тысячи долларов и стоили всем нам ценных частей глобального биоразнообразия.

Дикие кошки, как правило, практически не оказывают отрицательного воздействия на человека. (Новак, 1997)

Статус сохранения

Африканские и азиатские дикие кошки остаются довольно обычным явлением на всем своем ареале, хотя разрушение среды обитания продолжает приводить к потере подходящих мест обитания.

европейских диких кошек находятся под угрозой исчезновения в их естественном ареале. Они были в значительной степени истреблены из Западной и Центральной Европы в 19 и 20 веках, потому что считались опасными для дичи и домашних животных. Им по-прежнему угрожает потеря среды обитания, но популяции восстанавливаются во многих частях их прежнего ареала. Другие угрозы для европейских диких кошек включают изоляцию популяции, смерть от столкновения с автомобилем и уязвимость перед болезнями, передаваемыми домашними кошками.В настоящее время они находятся под охраной по всей Европе, и в настоящее время предпринимаются несколько попыток по их повторной интродукции.

Основной угрозой для всех популяций диких кошек, особенно европейских диких кошек, является продолжающаяся гибридизация (скрещивание) с домашними формами. Гибридизация приводит к снижению генетической чистоты диких форм. Некоторые исследователи предполагают, что генетически чистые европейские дикие кошки вымерли в результате обширной гибридизации.

Домашним кошкам ничего не угрожает.Вместо этого в большинстве областей необходимы механизмы контроля населения. (Группа специалистов МСОП, 1996a; Группа специалистов МСОП, 1996b; Группа специалистов МСОП, 1996c; Новак, 1997)

африканских диких кошек (F. silvestris libyca) обитали в городах на Ближнем Востоке не менее 7000 лет назад. Они были одомашнены в Египте около 4000 лет назад и начали появляться за пределами этой области около 2000 лет назад. Домашних кошек, вероятно, привлекало большое количество грызунов вблизи человеческих поселений, и они приветствовались как способ борьбы с популяциями грызунов.Однако истинное приручение могло иметь религиозную основу. Египетский культ, основанный в древнем городе Бубастис, поклонялся кошкам. Последователи богини удовольствия Баст создали святилища с бронзовыми статуями кошек и мумифицировали сотни тысяч кошек. По оценкам, в настоящее время существует более 30 пород домашних кошек. (Новак, 1997)

Авторы

Таня Дьюи (автор), Animal Diversity Web.

Глоссарий

Австралийский

Проживает в Австралии, Новой Зеландии, Тасмании, Новой Гвинее и связанных островах.

эфиопский

живут в Африке к югу от Сахары (к югу от 30 градусов северной широты) и на Мадагаскаре.

Неарктика

проживает в Неарктической биогеографической провинции, северной части Нового Света.Это включает Гренландию, канадские арктические острова и всю Северную Америку вплоть до юга до высокогорья центральной Мексики.

Неотропический

проживает в южной части Нового Света. Другими словами, Центральная и Южная Америка.

Палеарктика

проживает в северной части Старого Света.Другими словами, Европа и Азия и Северная Африка.

акустический

использует звук для общения

сельское хозяйство

человек живут на ландшафтах, где преобладает сельское хозяйство.

альтернативный

молодых рождаются в относительно слаборазвитом состоянии; они не могут кормиться, заботиться о себе или самостоятельно передвигаться в течение определенного периода времени после рождения / вылупления. У птиц голые и беспомощные после вылупления.

двусторонняя симметрия

, имеющий такую ​​симметрию тела, что животное можно разделить в одной плоскости на две зеркальные половины.У животных с двусторонней симметрией есть спинная и вентральная стороны, а также передний и задний концы. Синапоморфия билатериев.

Плотоядное животное

животное, которое в основном ест мясо

падаль

плоти мертвых животных.

чапараль

Обитает в прибрежных районах между 30 и 40 градусами широты, в районах со средиземноморским климатом. В растительности преобладают густые колючие кустарники с жесткими (твердыми или восковидными) вечнозелеными листьями. Может поддерживаться периодическим огнем. В Южной Америке он включает экотон кустарника между лесом и парамо.

химическая

использует запахи или другие химические вещества для общения

космополитен

имеет мировое распространение. Встречается на всех континентах (кроме, может быть, Антарктиды) и во всех биогеографических провинциях; или во всех основных океанах (Атлантический, Индийский и Тихий.

эндотермический

животных, которые используют выделяемое метаболическим путем тепло для регулирования температуры тела независимо от температуры окружающей среды. Эндотермия — это синапоморфия млекопитающих, хотя она могла возникнуть у (ныне вымершего) предка синапсидов; летопись окаменелостей не различает эти возможности. Сходится у птиц.

удобрения

союз яйцеклетки и сперматозоида

лес
В

лесных биомах преобладают деревья, в противном случае лесные биомы могут сильно различаться по количеству осадков и сезонности.

представлен

относится к видам животных, которые были перенесены в регионы за пределами их естественного ареала и сформировали их популяции, обычно в результате деятельности человека.

итеропарное

потомков производятся более чем в одной группе (пометы, клатчи и т. Д.).) и в течение нескольких сезонов (или других периодов, благоприятных для размножения). По определению, итеропородящие животные должны выживать в течение нескольких сезонов (или периодических изменений состояния).

подвижный

, имеющий возможность перемещаться с одного места на другое.

родной диапазон

район, в котором животное обитает в природе, регион, в котором оно является эндемиком.

ночной образ жизни

активен ночью

океанические острова

острова, которые не являются частью районов континентального шельфа, они не связаны и никогда не были связаны с континентальным массивом суши, чаще всего это вулканические острова.

восточный

найдено в восточном регионе мира. Другими словами, Индия и Юго-Восточная Азия.

зоотовары

— это бизнес по покупке и продаже животных, чтобы люди держали их дома в качестве домашних животных.

полигинный

имея более одной самки в качестве партнера одновременно

ароматические знаки

общается, выделяя запахи из специальных желез и помещая их на поверхность, чтобы другие могли почувствовать их запах или вкус

кустарник

кустарниковых лесов развиваются в районах с засушливым сезоном.

сезонное разведение

разведение привязано к определенному сезону

сидячий

остается на том же участке

половой

воспроизводство, включающее сочетание генетического вклада двух особей, мужчины и женщины

хранит или кэширует еду

помещает еду в специальное место, чтобы ее можно было съесть позже.Также называется «накопление»

пригородный

проживающих в спальных районах на окраинах крупных городов.

тактильный

использует прикосновение для связи

умеренный

, этот регион Земли между 23.5 градусов северной широты и 60 градусов северной широты (между тропиком Рака и Северным полярным кругом) и между 23,5 градусами южной широты и 60 градусами южной широты (между тропиком Козерога и Северным полярным кругом).

наземное

Живут на земле.

тропическая саванна и луга

Наземный биом.Саванны — это луга с разбросанными отдельными деревьями, которые не образуют закрытого полога. Обширные саванны встречаются в некоторых частях субтропической и тропической Африки и Южной Америки, а также в Австралии.

саванна

Пастбище с разбросанными деревьями или разбросанными группами деревьев, тип сообщества, занимающий промежуточное положение между пастбищами и лесами. См. Также Тропическая саванна и биом пастбищ.

пастбища умеренного пояса

Наземный биом, обнаруженный в умеренных широтах (> 23,5 ° северной или южной широты). Растительность состоит в основном из злаков, высота и видовое разнообразие которых во многом зависят от количества доступной влаги. Огонь и выпас скота важны для долгосрочного ухода за пастбищами.

городской

живут в городах и крупных поселках, в ландшафтах преобладают человеческие структуры и деятельность.

визуальный

использует зрение для связи

живородящие

размножение, при котором оплодотворение и развитие происходят в женском организме, а развивающийся эмбрион получает питание от самки.

Список литературы

Группа специалистов по кошкам МСОП, 1996. «Африканская дикая кошка, Felis silvestris, группа lybica» (Онлайн). Группа специалистов МСОП по кошкам; Учетные записи видов. Доступно 12 марта 2004 г. на http://lynx.uio.no/catfolk/sp-accts.htm.

Группа специалистов по кошкам МСОП, 1996. «Азиатская дикая кошка, Felis silvestris, ornata group» (Онлайн).Группа специалистов МСОП по кошкам; Учетные записи видов. Доступно 12 марта 2004 г. на http://lynx.uio.no/catfolk/sp-accts.htm.

Группа специалистов по кошкам МСОП, 1996 г. «Европейская дикая кошка, Felis silvestris, группа silvestris» (Онлайн). Группа специалистов МСОП по кошкам; Учетные записи видов. Доступно 12 марта 2004 г. на http://lynx.uio.no/catfolk/sp-accts.htm.

Новак, Р.1997. Млекопитающие Уокера в мире. Балтимор: Издательство Университета Джона Хопкинса. Доступно 12 марта 2004 г. на http://www.press.jhu.edu/books/walkers_mammals_of_the_world/carnivora/carnivora.felidae.felis.html.

Мы хотели знать, откуда взялись загадочные «лесные» кошки Мадагаскара. Что мы нашли

Мадагаскар, отделенный от всех других массивов суши с конца мелового периода, когда динозавры все еще доминировали во многих частях Земли, долгое время считался «естественной лабораторией эволюции».Его длительная изоляция привела к появлению уникальной фауны и флоры, большая часть которых эволюционировала на месте.

На Мадагаскаре есть только четыре группы эндемичных наземных млекопитающих: приматы (лемуры), грызуны, афротеры (ранее насекомоядные, такие как тенреки) и хищники. Тем не менее, в этих четырех группах существует огромное разнообразие.

Когда дело доходит до эндемичных наземных хищников, признается только одна группа: эвплериды. Из них самый крупный — фоса. Это не кошачьи (семейство кошачьих) и не псовые (семейство собак).Он тесно связан с мангустом и весит от 5 до 10 кг. Издавна он был основным хищником среди млекопитающих лемуров и других малагасийских млекопитающих.

Итак, общепринято считать, что на Мадагаскаре нет местных кошек (т. Е. Кошачьих). Тем не менее, кошек на острове много.

На Мадагаскаре есть два основных типа кошек: деревенские кошки и дикие «лесные» кошки. Эта «лесная кошка» давно отличается от малагасийских деревенских или одичавших домашних кошек и часто рассматривается как угроза для домашних животных, таких как домашняя птица.Судя по свидетельствам очевидцев и отчетам, в том числе нашим собственным, этот малоизученный дикая «лесная кошка» также является эффективным хищником знаменитых лемуров Мадагаскара.

«Лесные кошки» весьма различаются по внешнему виду: у них всегда «полосатый» или полосатый мех, более длинные ноги и больший размер (до 5 кг).

Лесной кот.

Напротив, «деревенские» кошки обычно выглядят как домашние кошки, которых можно встретить во всем мире — однотонный цвет шерсти (часто белый), более короткие ноги и размер тела около 2 кг.

Деревенский кот.

Таким образом, внешняя морфология лесных кошек сильно отличается от деревенских. Внешне он очень похож на африканских диких кошек, которых можно встретить в восточной и южной частях континентальной Африки.

Таким образом, происхождение мадагаскарских «лесных» или «диких» кошек долгое время оставалось загадкой. Происходят ли они от африканской дикой кошки ( Felis lybica ), прибывшей вместе с восточноафриканскими скотоводами, которые в культурном отношении доминируют в южных регионах Мадагаскара? Являются ли они продуктом недавно прибывших домашних кошек ( Felis silvestris ) из Европы, Аравии или Юго-Восточной Азии?

Чтобы определить происхождение «лесных кошек» Мадагаскара, мы и наши коллеги провели это исследование.

Наши находки показывают, что малагасийские «лесные кошки» являются потомками кошек из региона Аравийского моря. Они произошли не от диких кошек континентальной Африки, а скорее связаны с домашними кошками.

Слежка за кошкой

Наша команда — результат сотрудничества ученых из шести стран на трех континентах — собрала генетические данные 30 «лесных» кошек в двух местах на Мадагаскаре, трех особей из особого заповедника Беза Махафали на юго-западе и 27 особей из национального парка Анкарафанцика в крайний север острова.

Эти данные сравнивались с примерно 1900 образцами от различных домашних и диких кошек по всему миру, чтобы оценить степень родства малагасийских диких форм.

Данные, полученные нашей командой — объединяющие знания, опыт и навыки как полевых, так и лабораторных ученых — показали, что малагасийские «лесные кошки» наиболее тесно группируются с домашними кошками, особенно из региона Аравийского моря, включая кенийские острова Ламу и Паштет. Таким образом, малагасийские кошки являются потомками домашних кошек из региона Аравийского моря, а не диких кошек континентальной Африки.

Истоки

Когда и как зародилась эта диаспора? Кошки из Аравийского моря и Кенийских островов, вероятно, попали на Мадагаскар в прошлом тысячелетии или чуть раньше, благодаря торговле через Аравийское море. За последние 1000 лет или около того было несколько волн миграции на Мадагаскар из арабских владений.

Эти миграции принесли с собой архитектуру, лингвистические компоненты и, в конечном итоге, письменный шрифт 18 века. И они принесли кошек. Таким образом, «лесные кошки» Мадагаскара — это мигранты в океане из других мест — как и другие наземные млекопитающие Мадагаскара, хотя и из-за человеческого источника, а не естественных процессов «сплава», как, например, предки мадагаскарских лемуров.

Изучить или искоренить?

Что означает эта новая информация для этих кошачьих? Наши результаты предполагают, что «лесные кошки» Мадагаскара, возможно, были завезены тысячелетие назад, и если это так, изучение их поведения, биологии и экологии дает представление о том, как экзотические виды приспосабливаются к биогеографии острова, а также дает представление о расселении кошек.

Важно отметить, что наши выводы также поднимают вопросы о роли этих кошек в лесных экосистемах Мадагаскара. Следует ли их искоренить — по крайней мере, в охраняемых заповедниках — как это было сделано на других островах с точки зрения интродуцированных видов?

Вопросы сохранения, связанные с этими новыми данными, сложны и требуют вдумчивого разговора, чтобы понять всю историю «лесных кошек» Мадагаскара.

Сравнительная филогеография джунглевой кошки (Felis chaus) и леопардовой кошки (Prionailurus bengalensis) в Индии

Лабораторные методы

Поскольку пометы, собранные в естественных средах обитания, могут принадлежать нескольким хищникам, нам пришлось сначала отнести собранные пометы к видам наших животных. интерес. Для этого мы использовали протокол ПЦР-ПДРФ [20], основанный на гене 16 s рРНК для определенной доли помета, до тех пор, пока не было получено необходимое количество помета для каждого вида из каждой области.Чтобы избежать отбора проб одних и тех же или родственных особей (поскольку кошки проявляют филопатрию самок), по возможности мы отбирали пометы, которые были расположены в разных районах в пределах биогеографической зоны. Скаты, находящиеся в пределах 5 км друг от друга, включались только в том случае, если последовательности, полученные из них, отличались друг от друга (были отдельными гаплотипами). У нас было в общей сложности 40 леопардовых кошек и 55 пометов джунглей для дальнейшего анализа.

Праймеры

были разработаны с использованием существующих последовательностей для двух видов, а также последовательностей домашних кошек, загруженных из NCBI.Первоначально мы разработали праймеры для контрольной области с использованием последовательностей домашних кошек, поскольку последовательности для этой области для наших исследуемых видов не были доступны. Однако два набора праймеров, которые амплифицировали в общей сложности 377 п.н., работали с интересующими нами видами, но находились в неизменяемых частях контрольной области. С помощью этих праймеров мы секвенировали 10 особей лесной кошки из различных частей ее распространения (Северо-Восточная Индия, Верхние Гангские равнины, Южный и Центральный полуостров Декан, Западные Гаты, Нижние Гангские равнины и один из Ирака) и не обнаружили никакой разницы между ними.Поэтому мы выбрали следующие наиболее вариабельные области, NADH5 и цитохром b, на основании информации из Johnson and O’Brien (1997) [21]. В этих областях мы разработали несколько праймеров и секвенировали несколько особей обоих видов, прежде чем выбрать праймеры, которые амплифицировали наиболее вариабельную часть этих областей. Первоначально мы разработали набор праймеров для области цитохрома b для кошек из джунглей на основе последовательностей домашних кошек. Однако позже мы разработали другой набор праймеров для той же области, который амплифицировал более длинную часть, которая затем была использована для обоих видов.Поскольку мы уже сгенерировали последовательности для нескольких особей джунглей кошек с использованием предыдущей пары праймеров, мы усекли длину последовательности джунглей кошек для области цитохрома b. Следовательно, конечная длина области цитохрома b кошки джунглей меньше, чем у леопардовой кошки, хотя они происходят из соответствующих регионов. Последний набор праймеров, который мы использовали (), был для областей генов NADH5 (362 пары оснований для леопардовой кошки и 460 пар оснований для лесной кошки) и цитохрома b (202 пары оснований для леопардовой кошки и 141 пара оснований для лесной кошки).Поскольку большая часть нашей работы была на неинвазивных образцах (scat), которые являются относительно плохими источниками ДНК, нам пришлось амплифицировать несколько небольших фрагментов ДНК, чтобы получить требуемую общую длину (564 пары оснований для леопардовой кошки и 601 пара оснований для джунглей. Кот). Каждая из наших пар праймеров амплифицировалась между 100 и 200 парами оснований (). Мы стандартизировали температуры отжига праймеров для образцов крови, взятых у заключенных.

Таблица 1

Подробная информация о праймерах, использованных в исследовании.

Ген Название Последовательность (5 ′….3 ′) Виды Длина ампликона Температура отжига
NADH5 JCND5_159F JCND5_159R CCTATGCCTTTACCATCAGCA GTGCCACGGGAATGAAGAT Кот джунглей 98 п.н. 59 ° C
JCND5_210F JCND5_210R CTGTGGCACTTTTCGTCA TAAAGCGGCAGTGTTTGC Кот джунглей 186 п.н. 55 ° C
JCND5_4 F JCND5_4 R ATCCTCTACAACCGCATTGG AGACAGGAGTTGGGCCTTCT Кот джунглей и кот леопард 176 п.н. 59 ° C
LepcatND5 F LepcatND5 R GACCCATATATCAACCGA GCGTTTGAGTTAGTAAGG Леопардовый кот 186 п.н. 55 ° C
Cyt b HCJC FHCJC R ATCTCAGCCTTAGCAGCA TTGTCTGGGTCTCCTAGC Кот джунглей и кот леопард 141 bp202 bp 50 ° C
LepcatCytb2 F LepcatCytb2 R CTGTCTATACATGCACGT TGGCTTTGTCTACTGAGA Леопардовый кот 239 п.н. 56 ° C
LepcatCytb3 F LepcatCytb3 R CATCTTAGGCCTTCTAGT GGAGGATTGGAATGATTG Леопардовый кот 236 п.н. 52 ° C

ДНК экстрагировали с использованием наборов ткани и стула QIAmp (QIAGEN) в соответствии с протоколами производителя с небольшими изменениями [22].Все экстракции проводились в среде без ПЦР, чтобы снизить вероятность контаминации. Экстракты помета и крови проводились в отдельных помещениях, чтобы свести к минимуму вероятность заражения фекалиями из крови. Поскольку образцы в основном были фекальными, мы включили контроли со всеми экстрактами для мониторинга загрязнения. ПЦР-амплификации проводили в реакциях ПЦР на 10 мкл с использованием мастер-микса для ПЦР (QIAGEN, Inc.), 4 мкг бычьего сывороточного альбумина (Sigma) и 2 мкМ праймеров с использованием следующей программы: Инициирование при 94 ° C в течение 10 мин, затем 94 ° C в течение 30 с, 49–60 ° C (отжиг, в зависимости от пары праймеров, см.) В течение 45 секунд, 72 ° C в течение 50 с, затем 10 мин при 72 ° C, повторение 59 циклов.Все реакции ПЦР включали контроли для мониторинга загрязнения, как это требуется для неинвазивных образцов.

Кроме того, мы разработали праймеры с использованием существующих последовательностей цитохрома b леопардовой кошки [23] и сравнили в общей сложности 575 п.н. (два новых фрагмента 239 п.н. и 236 п.н. вместе со 100 п.н. ранее секвенированной части) индийских последовательностей с последовательностями из Восточная и Юго-Восточная Азия. Для этого было использовано всего 5 образцов (по одному с Северо-Востока, Восточных Гималаев и Западных Гималаев и по два из Западных Гат).Используемая программа ПЦР была такой же, как и выше, с температурами отжига 56 ° C для пары праймеров Lepcatcytb2 и 52 ° C для Lepcatcytb3. Это было сделано только для леопардовой кошки, поскольку последовательности популяций из-за пределов Индии были доступны только для этого вида [23].

ПЦР-продуктов визуализировали на 2% агарозном геле, и продукты очищали с использованием смеси экзонуклеаза-щелочная фосфатаза креветок (соотношение 0,7-1) (USB Corporation) перед секвенированием. Продукты секвенировали как в прямом, так и в обратном направлении с использованием набора для секвенирования ABI Big Dye Terminator в автоматическом секвенаторе ABI 310 (Applied Biosystems).

Мы случайным образом выбрали несколько скатов (которые показали новые гаплотипы после секвенирования) и повторили весь процесс от экстракции до секвенирования, чтобы проверить достоверность новых гаплотипов.

Анализы

Последовательности выравнивали с помощью программы MEGA [24]. Используя комбинированные области NADH5 (303 п.н.) и цитохрома b (141 п.н.), мы выбрали уникальные гаплотипы для обоих видов. Используя кошку-рыболов в качестве внешней группы, мы построили филогенетические деревья с использованием программного обеспечения PAUP * (версия 4.0) [25] и модели, наиболее подходящей для частот нуклеотидов, отношения переход-трансверсия и нуклеотидного замещения по информационному критерию Акаике (AIC) [26]. ] в ModelTest (версия 3.8) [27], [28]. Мы использовали метод Neighbor Joining (NJ) [29], основанный на расстояниях Джукса-Кантора с 1000 повторениями начальной загрузки, а также метод максимального правдоподобия (ML) [30] с 500 повторениями начальной загрузки на основе эвристического поиска.

Области NADH5 и цитохрома b были объединены для каждого вида (кошка из джунглей: 460 п.н. NADH5, 141 п.н. цитохром b, леопардовая кошка: 302 п.н. ] с помощью программы NETWORK (версия 4.5.1.0; http://www.fluxus-engineering.com).

Для леопардовых кошек с помощью PAUP * с 575 п.н. цитохрома b было построено отдельное дерево максимального правдоподобия на основе эвристического поиска и 500 реплик начальной загрузки, а также дерево соединения соседей с расстояниями Джукса-Кантора и 1000 копий начальной загрузки. и последовательности, включенные в более раннее исследование [23], с использованием кошки-рыболова в качестве внешней группы. Сеть гаплотипов с медианным соединением для того же набора данных также была построена с использованием программы NETWORK.

Внутрипопуляционные показатели разнообразия (количество гаплотипов, генетическое разнообразие, нуклеотидное разнообразие (π), среднее попарное различие (θπ) и количество сегрегационных сайтов (θs)) были рассчитаны для каждого вида с использованием программного обеспечения ARLEQUIN (версия 3 .1) [32]. Генетическая структура двух видов была исследована с помощью F . st с попарными различиями, используя анализ молекулярной дисперсии (AMOVA). Это было сделано для всех категорий объясняющих переменных, включая биогеографические классы, широтные диапазоны и подвидовую классификацию.

Мы следовали таксономической классификации подвидов кошек джунглей и леопардовых кошек Покока 1939 года [16]. Он описал четыре подвида кошек джунглей в Индии на основе морфологических признаков.Это были F. c. affinis (Гималаи), F. c. kutas (северная полуостровная Индия), F. c. prateri (пустыня Тар) и F. c. kelaarti (южная Индия). Покок 1939 [16] разделил популяции леопардовых кошек в Индии на два подвида. Он назвал Гималайские P. b. horsfieldi и объединил население Северо-Восточной и Южной Индии в группу под названием P. b. bengalensis . Для группировки по широте мы использовали классы 10 ° N – 19,9 ° N, 20 ° N – 28.9 ° с.ш. и 29 ° -35 ° с.ш., которые в целом определяют юг, центральную и северную Индию соответственно.

Таджима D [33] и F Фу [34] были рассчитаны с помощью 1000 симуляций, чтобы проверить нейтральность и демографическую историю, и мы использовали анализ несоответствия для обоих видов, чтобы оценить демографические параметры прошлой экспансии популяции [35] Эти параметры ( τ, θ 0 и θ 1 ), оцененные с помощью обобщенного нелинейного метода наименьших квадратов с доверительными интервалами, вычисленными с использованием параметрического подхода начальной загрузки, были получены с использованием ARLEQUIN (версия 3.1) [32]. Популяция расширяется от начального θ 0 до θ 1 в единицах τ мутационного времени (τ также является режимом распределения несовпадений), где θ = 2N e * µ (N e — эффективное размер популяции самок, µ — частота мутаций на поколение для исследуемой последовательности). Время с момента расширения (в поколениях) можно рассчитать как t = τ / 2 µ [32], [36]. Мы подсчитали время, прошедшее с момента экспансии для кошки из джунглей, с последовательностью 601 п.н. из NADH5 и цитохрома b, оценочная скорость мутации равна 1.3% / bp / миллион лет (комбинированная скорость цитохрома b (1,38% MY) [37] и NADH5 (1,22% MY) [38]) и время генерации в год.

Кроме того, мы проверили, коррелируют ли географические и генетические расстояния (изоляция по расстоянию) у двух видов, используя биогеографическую и таксономическую классификацию для группировки популяций лесных кошек и только таксономическую классификацию леопардовых кошек, поскольку биогеографическая группировка у этого вида было всего две популяции. Мы сгенерировали географические расстояния между людьми с помощью программы Geographic Distance Matrix Generator (версия 1.2.3) [39] и взяли среднее расстояние между особями одной популяции и особями другой. Мы проверили связь между попарными географическими и генетическими расстояниями ( F st ) путем проведения теста Mantel с использованием программного обеспечения IBD (версия 1.53) [40] без преобразования журнала и с 10 000 рандомизаций для получения значений статистической значимости.

Для объяснения генетического паттерна, наблюдаемого у леопардовой кошки, мы исследовали, как нынешние климатические паттерны могут повлиять на его распространение, используя анализ нишевой модели.Уникальные местоположения леопардовой кошки с географической привязкой (широта и долгота) (n = 140) были получены из музейных образцов по всему миру, из текущего исследования, из литературы [16], [23], [41], а также из локаций. сообщили другие лица, удостоверенные фотографиями. Из деталей ваучерах и этикетках на образцы мы подтвердили, что ни одна из этих записей не дублировалась (поскольку многие образцы в литературе Покока (1939) [16]) являются экземплярами, хранящимися в Бомбейском обществе естественной истории и Музее естественной истории (Лондон). ) коллекции.Записи образцов музеев были получены путем переписки, посещения некоторых музеев, из Глобального информационного фонда по биоразнообразию (доступ через портал данных GBIF, www.gbif.net, 15 декабря 2008 г.) и из сетевой информационной системы по млекопитающим (доступ через портал MaNIS http://manisnet.org, 15 декабря 2008 г.). Мы получили записи о местонахождении из Бомбейского общества естествознания, Музея естественной истории (Лондон), Смитсоновского национального музея естественной истории (Вашингтон), Полевого музея (Чикаго), Музея естественной истории округа Лос-Анджелес (Лос-Анджелес), Канзасского университета. Центр исследований биоразнообразия (Канзас), Шведский музей естественной истории (Стокгольм), Музей естествознания (Берлин), Калифорнийская академия наук и Музей зоологии Мичиганского университета (Мичиган).

Мы извлекли биоклиматические данные из набора данных WORLDCLIM (версия 1.4, http://www.worldclim.org/bioclim.htm) [42] с интервалами 2,5 мин. Этот набор данных за 50-летний период (1950–2000), собранный на нескольких глобальных метеостанциях, использует годовые тенденции, экстремальные значения и сезонность температуры и осадков для получения биологически значимых переменных [43]. 19 биоклиматических переменных (среднегодовая температура, среднемесячный диапазон температур, изотермичность (2/7 * 100), сезонность температуры (стандартное отклонение месячной температуры * 100), максимальная температура самого теплого месяца, минимальная температура самого холодного месяца, годовая температура диапазон (5–6), средняя температура самого влажного квартала, средняя температура самого засушливого квартала, средняя температура самого теплого квартала, средняя температура самого холодного квартала, годовые осадки, Осадки самого влажного месяца, осадки самого засушливого месяца, сезонность осадков (CV), осадки самого влажного квартала, осадки самого сухого квартала, осадки самого теплого квартала, осадки самого холодного квартала).

Поскольку корреляция между переменными может привести к переобучению модели [44], мы вычислили коэффициент корреляции Пирсона ( r ) между каждой парой переменных, используя статистическое программное обеспечение SPSS 16.0. Корреляция была проведена путем извлечения климатической информации из 400 уникальных, случайно сгенерированных точек в пределах глобального распределения двух кошек с использованием DIVA-GIS (версия 7.1.7.2, http://www.diva-gis.org). Мы выбрали 8 переменных, которые не были сильно коррелированы друг с другом, используя r = 0.7 как отрезанный. Это были максимальная температура самого теплого месяца (Био 5), годовой диапазон температур (Био 7), средняя температура самого засушливого квартала (Био 9), средняя температура самого холодного квартала (Био 11), осадки самого влажного месяца (Био 13), сезонность осадков (Био 15), осадки в самой теплой четверти (Био 18) и осадки в самой холодной четверти (Био 19). Эти переменные были выбраны среди других, потому что они включали экстремальные климатические условия (Био 5, Био 7) и другие, которые, по нашему мнению, были более значимыми с биологической точки зрения.Мы выбрали экстремальные климатические факторы, поскольку они, возможно, являются лучшими экологическими индикаторами распространения видов и границ ареала, чем средние значения.

Мы разработали модели распределения с использованием двух различных методов: максимальной энтропии [45], которая является относительно более сложной и надежной моделью [46], и BIOCLIM [47], которая более проста в расчетах. Для построения моделей мы использовали программное обеспечение MaxEnt (версия 3.3.2) и DIVA-GIS (версия 7.1.7.2, http://www.diva-gis.org). Подход максимальной энтропии использует алгоритм машинного обучения, который предполагает равномерное распределение вероятностей присутствия в интересующей области с учетом определенных ограничений, обеспечиваемых распределением известных присутствий по факторам окружающей среды.Модель подогнана и улучшена за несколько итераций. Для построения модели он использует данные о присутствии, фон из случайно выбранных точек, которые он создает из интересующей области, и климатические особенности для каждой точки. Окончательная карта предсказывает пригодность среды обитания как вероятность присутствия, где ноль указывает на непригодность, а один очень подходит [45], [46].

В отличие от этого, BIOCLIM основан на методе эвристического поиска, который измеряет значения окружающей среды из известных местонахождений видов (данные только о присутствии) для выявления других областей с диапазонами окружающей среды, заключенными в эти области.Огибающие рассчитываются для каждой климатической характеристики / переменной с максимальными и минимальными значениями точек присутствия. Результаты представлены в виде пригодности среды обитания, которая определяется процентилем точек, попадающих в границы. Области с точками, попадающими во все оболочки, представляют собой наиболее подходящую среду обитания [47].

Мы использовали следующие настройки для модели MaxEnt: десять реплик в пакетном режиме с автоматическими функциями (где типы функций выбираются программой на основе размера обучающей выборки), тесты складного ножа, логистический выходной формат, случайный процент тестирования = 25, тип прогона репликации = перекрестная проверка, множитель регуляризации = 1, максимальное количество итераций = 500, порог сходимости = 0.0001 и максимальное количество фоновых точек = 10 000. Для модели BIOCLIM мы использовали опцию выборочной точки для генерации случайных точек псевдо-отсутствия с десятью повторами (т.е. 140 случайных точек были сгенерированы 10 раз независимо). Тренировочные (75% всех точек присутствия, отобранных случайным образом) и тестовые данные (25% от общего количества точек, отобранных случайным образом) также были отобраны с помощью 10 отдельных повторов с использованием той же опции. Данные обучения были запущены как пакетный файл с использованием опции BIOCLIM после выбора интересующих климатических переменных.Огибающие были установлены на уровне отсечения 0,025 процентиля, чтобы исключить экстремальные климатические значения (т. Е. Огибающие охватывали вариации климатических переменных, соответствующих местам, в пределах 97,5 процентиля, и все значения, выходящие за его пределы, были исключены как выбросы). Далее, используя вариант оценки, обучающие реплики тестировали с тестовыми репликами для получения значений AUC.

Мы оценили и сравнили модели из двух различных подходов, используя статистику кривой работы приемника (ROC) / AUC (площадь под кривой).Кривая ROC отображает способность модели прогнозировать истинное присутствие (специфичность) в сравнении с ее ложными срабатываниями (ошибка комиссии) по всем возможным пороговым значениям. Затем по графику ROC рассчитывается AUC как порогово-независимая мера производительности модели. Значения AUC варьируются от 0 до 1, где одно указывает на идеальное предсказание, 0,5 — предсказание, которое не будет отличаться от случайного, и все значения меньше 0,5 будут указывать на плохое предсказание [48].

Для окончательных карт прогнозируемой пригодности среды обитания от MaxEnt и BIOCLIM были использованы все 140 уникальных точек данных о присутствии леопардовой кошки.В BIOCLIM всем переменным присваиваются равные веса, и, следовательно, у него нет функции взвешивания переменных, тогда как в MaxEnt переменные взвешиваются (измеряются как усиление) в соответствии с тем, как они влияют на соответствие модели. Следовательно, вклад каждой переменной в окончательный прогноз был определен только для MaxEnt. Прирост можно объяснить как вклад переменной в соответствие модели, где увеличение прироста за счет переменной приводит к лучшему соответствию. В MaxEnt тест складного ножа проводился как для обучающих, так и для тестовых данных, а также для AUC на тестовых данных.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *