Иж 43кн: Короткая курковка ИЖ-43КН — моя мечта! | Охотник выходного дня

Содержание

Ружье МР-43КН орех, текстолитовый затыльник, 3 чока 12/70 L=725

Ружье МР-43КН орех, текстолитовый затыльник, 3 чока 12/70 L=725.

Ружье МР-43KH 12 70 орех (ствол 725 мм)- двуствольное ружье для ценителей классической охоты. Гладкоствольные ружья с горизонтальным расположением стволов производятся на Ижевском механическом заводе более 55 лет и имеют репутацию недорогих, исключительно надежных, обладающих прекрасным боем ружей.

Особенности:

 

 

  • — высокую степень безопасности в обращении с ружьём при ходовых охотах и при охоте в чаще леса обеспечивает надёжная конструкция автоматического предохранителя, запирающего шептала и спусковые крючки;
  • — хороший баланс ружья обеспечивает удобное и быстрое прицеливание;
  • — классическая, наиболее распространенная в современном оружии конструкция затвора с запиранием на два подствольных крюка рамкой Пердэ;
  • — для защиты от коррозии каналы и патронники хромируются;
  • — ружье производится как с постоянными дульными сужениями, так и со сменными дульными насадками, обеспечивающими стабильную кучность стрельбы;
  • — цевье и приклад ружья ИЖ-43 и его модификации изготавливаются из высококачественного ореха или бука; предлагаемые варианты исполнения МР-43 позволяют выбрать ружье с различными потребительскими свойствами для различных целей;
  • — длина ствола — 725 мм.

 

 

Как купить гладкоствольное ружье ружье МР 43 КН орех, текстолитовый затыльник 725?

Предупреждаем! Лицензионные товары не доступны к покупке через интернет-магазин. Приобрести лицензионный товар Вы можете в нашем магазине Air-Gun.ru только посредством самовывоза. Квалифицированный персонал даст полную консультацию по изделию, уходу за ним и ответит на все интересующие Вас вопросы.

Обращаем внимание, что для приобретения огнестрельного оружия и патронов необходимо предоставить лицензию! Ознакомиться с правилами и порядком получения Вы можете в разделе Лицензия.

Поиска ИЖ-43КН псто. — Русское оружие. — LiveJournal

Mon, Nov. 10th, 2014, 09:29 pm


pavel_pavlenko: Поиска ИЖ-43КН псто. И снова здравствуйте =)

Проникшись советами к прошлому моему посту касательно латунных гильз, я решил озадачиться получением второй зелёнки чтобы купить двустволку. Просуммировав все факторы и пожелания, пришёл к выводу, что самым оптимальным выбором будет ИЖ-43 КН в 510 стволе, так как она:

— горизонталка

— честная курковка

— короткая

— тёплая и ламповая


Почитав интернеты, понял, что как почти у любого отечественного оружия, у данной модели очень много врождённых косяков, при том в массе своей рандомных, по принципу «был ли трезв сегодня мастер» — то есть можно наткнуться как на довольно неплохой экземпляр, так и на тотально кривой. Небольшого напилинга и доводки механизма я не босюь, а вот криво просверленных или так же спаянных стволов — опасаюсь, поэтому заказ в Ижевске кота в мешке оставил как крайний вариант.

Посему вопрос — не видел ли кто из уважаемых сообщников это ружьё в продаже в ормагах/ с рук? Желательно Москва-Тула-области или окрестности.

Заранее всем спасибо и хороших патронов =)

ЗЫ: открыт для диалога и легко внушаем могу быть переубеждён при наличии аргументов.

Mon, Nov. 10th, 2014 06:32 pm (UTC)


fostral2: как раз продаю такое, но стволы 725 .

Mon, Nov. 10th, 2014 08:06 pm (UTC)


pavel_pavlenko: Re: как раз продаю такое, но стволы 725 Жалко, что длинноствол… но всё-таки запрошу фотки и цену 🙂 Вдруг совсем не найду короткую версию?

Mon, Nov. 10th, 2014 06:48 pm (UTC)


3jio6a Являюсь владельцем как раз 43КН, но 1) в Поволжье, 2) не продаю. Уж очень прикипел. Кстати, брал в ларьке по принципу «чтоб зеленка не сгорела», а оказался очень удачный выбор.

Mon, Nov. 10th, 2014 08:06 pm (UTC)


pavel_pavlenko Надеюсь присоединиться к клубу =)

Tue, Nov. 11th, 2014 05:19 am (UTC)


call_me_doc Поддерживаю по обеим пунктам.

Супруга давеча, подержавшись за дамские Лебо и Франкотт 28 калибра, прониклась и возжелала. Пришлось достать из кейса «отечественный аналог» 🙂 и пообещать на нее переоформить, если пройдет комиссию и т.п.

Док

Mon, Nov. 10th, 2014 07:03 pm (UTC)


pk_m Мое впечатление что весь Питер ими завален. И в 510мм/лупара варианте тоже.
Ибо на кой эта кочерга нужна, если она не лупара?

Mon, Nov. 10th, 2014 08:07 pm (UTC)


pavel_pavlenko А в Москве что-то никак не могу найти, хотя ещё пару лет назад попадались регулярно. Как сквозь землю провалились!

Mon, Nov. 10th, 2014 09:10 pm (UTC)


korabelny_kot Недавно просматривал сайт климовского темпгана — вроде там было.

Tue, Nov.

11th, 2014 05:08 am (UTC)
kamyak Оно вам точно надо?
Стрелял из этого чуда, у брата такое. Обрез обрезом. Отдача с него настолько не гуманная, особенно пулей! И из-за коротких стволов без наушников стрелять очень некомфортно. Плюс курки, которые поначалу прикольные, а потом задалбываешься их взводить.
Ружье не для охоты совершенно. Если паянные трубы охота, приглядитесь к чему-нибудь более практичному для охоты.
А этот коротыш для сельских пострелушек, вы с него много стрелять не будете.

Tue, Nov. 11th, 2014 07:47 am (UTC)


pavel_pavlenko Мне как раз для пострелушек, в общем-то — охотник из меня так себе.

Tue, Nov. 11th, 2014 08:28 am (UTC)


kamyak Ну если для фана, тогда без разницы. Лучше дульнозарядное тогда. Дымарем прикольно палить.

Tue, Nov. 11th, 2014 12:18 pm (UTC)


Голиков Евгений Паша, у меня такое есть, в нужной тебе комплектации.. продать не продам (слишком долго, т.
к. надо в регион гнать), а поиграться на стенде или где угодно дам. Попутно объясню что как, что удобно и неудобно.

Брал в Охотнике на Каланчевской за 12к себе на ДР.

http://cs410520.vk.me/v410520652/5d51/kGJ1O60ZFKM.jpg
http://cs308823.vk.me/v308823112/4da9/vdaux3bfJyU.jpg

Tue, Nov. 11th, 2014 01:08 pm (UTC)


pavel_pavlenko Окей, буду иметь ввиду, спасибо большое!

Tue, Nov. 11th, 2014 04:54 pm (UTC)


savelei

Есть такое. Шесть лет простояло в сейфе.Настрел 10шт. Москва. Пишите договоримся. [email protected]

Tue, Nov. 11th, 2014 08:28 pm (UTC)


pavel_pavlenko Хорошо, как получу на руки зелёнку — свяжусь =)

МР-43КН как оружие самообороны и для охоты / Стрелковое оружие и военно-спортивные игры / НеПропаду

Вот решил написать небольшую статейку, навеянную мыслями о пневматике и применения её для охотничье-самооборонных нужд. Разумеется не как абсолютную истину, а как вполне бютжетную и эффективную альтернативу.

В общем, недавно себе взял новую громпалку в качестве компактного и относительно мало весящего оружия, для самообороны от зверья хищного, с возможностью поохотится. Мой выбор пал на МР-43КН. Цена вопроса в моих палестинах — 18 килорубликов. Думаю вполне бютжетно.
Это классическая двудулка с горизонтально расположенным блоком стволов, открытыми курками.
Калибр 12гауди. Патронник под гильзу 70мм. Длинна стволов 51 сантиметр — считай в рюкзак в разобранном виде влазят запросто и излишнего внимания не привлекают. Вес изделия — 3,4кг. Даже если самим не крутить патроны, в продаже ассортимент патронов довольно широкий. Если говорить про дробовые, то бикасина и заканчивая картечью.
Вот общей вид.

Разбирается на три части — приклад с казённой частью и УСМ, блок стволов, цевьё.
Вот фотка.

Для удобности транспортировки цевьё можно пристегнуть к стволам.

Стволы имеют сверловку цилиндр. Что разумеется не идеально, учитывая их длинну, но стрельнув с дистанции в 25 метров по 16-ти дольной мишени — вполне дают хорошую осыпь дроби, думал всё будет значительно хуже.
При стрельбе пулей «полева-3» из самокатанных патронов, уверенно поражается лист А4 на дистанции 50 метров.
Выводы — рядового исполнения ружьё, вполне годное для самообороны от хищников, с возможностью бить для приварка того же поднятого фазана.
Достоинства:
— компактно
— имеет довольно малый вес
— отдача вполне комфортна, благодаря довольно «приятной» пятке-амортизатору на прикладе.
— имеет удобный стандартный предохранитель, а так же возможность в заряженном виде взвести и спустить курки УСМ.
Вот пояснительные фотки.

Предохранитель в положении «предохранитель — включен, курки не взведены»

Вот в положении предохранителя — огонь, курки взведены.

Вот соответственно вид сбоку.

Это вид на открытые стволы со стороны патронника — эстрактор стандартный, нормально удаляет гильзы как с «низким», так и с «средним» и «высоким» латунным или латунированным донцем.
Теперь о недостатках. Подумывал разумеется заказать с завода со сменными чёками(говорят такие есть в природе при данной длине стволов) Но откровенно — лень было заморачиваться. Потому, бой дробью, скажем так, не идеальный. Надо самому крутить патроны или использовать покупные, у которых дробовой заряд уложен в контейнер или пыж-контейнер.
Ружьё прежде всего расчитано на пулевую стрельбу. О чём кстати и говорит соответственная маркировка. Вот фотка.

Плохо видно обозначение сверловки стволов, но если приглядеться, то «нули-цилиндры» можно рассмотреть.
Нет тактически-стратегических планок пикатини, для крепления фонаря, ночного прицела и губной гармошки, но думаю, они лишние в «классике».
Их тюнинга для удобности переноски вкрутил быстрочъёмную антабку в полупистолетную рукоятку приклада.

Вот общий план.

Ну и повесил кожаный патронташ на 6-ть патронов на приклад. Остальные телодвижения на счёт тюнинга считаю излишними и вредными. Тем более дерево цевья и приклада — орех, подогнано хорошо и качественно. Настрел у меня около 100 патронов дробовых-пулевых. Как написано в «букваре» — паспорте, надо следить и подкручивать винты, пока не открутились.
Это наверное потому, что я как принёс с магазина, все «критичные» винтовые соединения раскрутил и нанёс «локтайт» синий и обратно закрутил с примерно теми же усилиями, применив динамометрическую отвёртку.
Выводы, которые вынес из «общения» с данной громпалкой — за свои деньги, это вполне качественное сделанное рядового исполнения ружьё, с вполне приемлимыми для самообороны и для охоты ТТХ при стрельбе дробью на 30-ть шагов и пулей на 60-т(25 метров и 50 метров соответственно).

ГЛАДКОСТВОЛЬНОЕ ОРУЖИЕ ИЖ-43КН — PDF Free Download

ТЕМА 5. Охотничьи товары

ТЕМА 5 Охотничьи товары Классификация охотничьи ружья; боеприпасы; принадлежности для снаряжение патронов; охотничье снаряжение. Охотничьи ружья Ружье гладкоствольное или комбинированное стрелковое оружие,

Подробнее

ГЛАДКОСТВОЛЬНОЕ ОРУЖИЕ ИЖ-58

Юрий Максимов В наши дни прослеживается повышенный интерес охотников к старым ружьям, произведенным во времена СССР. Помимо ностальгического фактора, влечение к «доперестроечному» оружию обусловлено снижением

Подробнее

Паспорт охотничьего ружья ТОЗ-34

Паспорт охотничьего ружья ТОЗ-34 1. ОБЩИЕ УКАЗАНИЯ ВНИМАНИЕ! Прежде чем пользоваться ружьем, необходимо изучить его описание и правила эксплуатации, изложенные в настоящем паспорте. Ружье может иметь некоторое

Подробнее

ГЛАДКОСТВОЛЬНОЕ ОРУЖИЕ САЙГА-12. ТЮНИНГ

САЙГА-12 ТЮНИНГ Юрий Максимов Когда Сайга-12 появилась в продаже, прилавки оружейных магазинов отнюдь не изобиловали разнообразием отечественного гладкоствольного оружия. Импортное же было дорогим и потому

Подробнее

ПОМПОВОЕ РУЖЬЕ TAURUS ST-12

ПОМПОВОЕ РУЖЬЕ TAURUS ST-12 Руководство пользователя СОДЕРЖАНИЕ 1. Меры безопасности при обращении с оружием 2. Основные части 3. Регулируемый приклад 4. Патроны 5. Инструкция по применению 6. Разборка

Подробнее

Паспорт охотничьего ружья ТОЗ-106

Паспорт охотничьего ружья ТОЗ-106 1. ОБЩИЕ УКАЗАНИЯ ВНИМАНИЕ! Прежде чем пользоваться ружьем, необходимо изучить его описание, правила эксплуатации и требования безопасности, изложенные в настоящем паспорте.

Подробнее

Что такое хороший бой ружья?

Г лавное достоинство рабочего ружья — это его бой, утверждает почти каждый автор, пишущий о выборе ружей. Но редкий из них находит нужным привязать параметры боя дробовика к особенностям тех способов охоты,

Подробнее

Впоследнее время под.

Римас Норейко

Римас Норейко Возрождённая классика Охотничье оружие Ижевского механического завода Одним из путей развития базовых моделей охотничьего оружия является создание их новых модификаций. Изменения, внесённые

Подробнее

ГЛАДКОСТВОЛЬНОЕ ОРУЖИЕ МЦ

МЦ 20-01 Юрий Максимов Как только в нашей стране не называли это легкое, надежное, недорогое и добычливое ружье. Легендарную промысловку, разработанную в начале 60-х, под руководством Ю.И.Березина, охотствующий

Подробнее

.308 Win (7,62х51 NATO). 15

«» С АМЕРИКАНСКИМ АКЦЕНТОМ Мы уже рассказывали о хорошо известном российском карабине серии «Лось» (март/2004). Тогда речь шла о версии под чрезвычайно мощный патрон 9,3х64 мм. Мы тогда отметили, что этот

Подробнее

IZHEVSKY MEKHANICHESKY ZAVOD

0523652 OJ IZHEVSKY MEKHANICHESKY ZAVOD Tel: +7 3412 76 28 55 E-mail: [email protected] ru http://» P R E S S R E L E A S E Россия Москва, 27.09-30.09.2004 Федеральное государственное унитарное предприятие

Подробнее

Первые же встречи российских

Тройной удар D99 Сергей Попиков На современном рынке охотничьего оружия очень мало свободного места для вновь создаваемых моделей. С развитием станкостроительного производства и новых технологий конкуренция

Подробнее

Peter Hofer Jagdwaffen — Zeitungsartikel Master Ruzschio 9/2016

Сеты ружей от Петера Хофера: элитарны, как королевская горностаевая мантия 26 åäëíöêêìüú 234 ÒÂÌÚfl apple 2016 Подобные ружья бывают только ручной работы, и времени на их изготовление уходит втрое, а то

Подробнее

В интересах стрелкового спорта

Галина Валеева В интересах стрелкового спорта Спортивные новинки «Ижмеха» для начинающих спортсменов Правительством Российской Федерации принята Федеральная целевая программа «Развитие физической культуры

Подробнее

НАРЕЗНОЕ ОРУЖИЕ ВПО-201 «БЕКАС- М АВТО»

«ТРЕХДЮЙМОВЫЙ» «БЕКАС» ВПО-201 «БЕКАС- М АВТО» Рискнем утверждать, что самозарядное гладкоствольное ружье с трубчатым подствольным магазином — это, прежде всего, охота на водоплавающую дичь. Конечно, кто-то

Подробнее

Галина Валеева ИЖ-27 вчера и МР-27 сегодня

оружие \ \ ружьё Галина Валеева ИЖ-27 вчера и МР-27 сегодня История зарождения производства охотничьих ружей на Ижевском механическом заводе начинается с 1949 г., когда, во исполнение директивных решений

Подробнее

Паспорт охотничьего ружья SP

Паспорт охотничьего ружья SP ДВУСТВОЛЬНОЕ РУЖЬЕ С ВЕРТИКАЛЬНОСПАРЕННЫМИ СТВОЛАМИ КАЛИБР 12/76 и 20/76 ПРАВИЛА БЕЗОПАСНОГО ОБРАЩЕНИЯ С ОРУЖИЕМ Как владелец огнестрельного оружия Вы должны принять к сведению

Подробнее

высокоточная стрельба \ \ практика

Алексей Сорокин Техника стрельбы Технику стрельбы в коротком бенчресте можно разделить на две важные составляющие: техника стрельбы и техника чтения ветра. Первая часть включает в себя прицеливание, спуск,

Подробнее

Руководство по эксплуатации

MANNLICHER Полуавтоматический карабин AUG A2 калибр 5,56 (. 223 Rem.) Руководство по эксплуатации ВНИМАНИЕ — НЕ ВЫБРАСЫВАТЬ ХРАНИТЕ ЭТО РУКОВОДСТВО ПО ЭКСПЛУАТАЦИИ ВМЕСТЕ С ВАШИМ ОГНЕСТРЕЛЬНЫМ ОРУЖИЕМ ЕСЛИ

Подробнее

Ружьё для спортинга. Владислав Буянов

Владислав Буянов Оружие для каждого вида спорта обладает своими отличительными чертами. Для того чтобы получить наиболее полное представление об оружии для спортинга, необходимо рассмотреть его особенности

Подробнее

KRX. Производитель: KRAL AV SANAYI MUTEAHHITLIK TIBBI MALZEMELER SAN. VE TIC. LTD. STI., Turkey, Konya, Beysehir, Uzumlu, Fatih Mah Ataturk Cad No.

Производитель: KRAL AV SANAYI MUTEAHHITLIK TIBBI MALZEMELER SAN. VE TIC. LTD. STI., Turkey, Konya, Beysehir, Uzumlu, Fatih Mah Ataturk Cad No. 85 Импортер: ООО «Ижевский Арсенал», 426039, Россия, г. Ижевск,

Подробнее

НАРЕЗНОЕ ОРУЖИЕ КАРКБИН ТИГР-9

ТИГР-9 ХОЗЯИН ТАЙГИ Наш журнал неоднократно рассказывал о карабинах серии «Тигр». Помимо «классического», в последние годы появились и другие модификации легендарного ижевского карабина. Существуют исполнения

Подробнее

ТРАВМАТИЧЕСКОЕ ОРУЖИЕ ОСА 4-1 МЛ

ЕСТЬ ТОЛЬКО МИГ МЕЖДУ ВЫСТРЕЛОМ… ПБ 4-1 МЛ «ОСА» Среди гражданского оружия самообороны особняком стоит травматический бесствольный пистолет «ОСА» ПБ-4 в разных модификациях. За последние несколько лет

Подробнее

ИСТРЕБИТЕЛЬ.308-ГО КАЛИБРА

ИСТРЕБИТЕЛЬ.308-ГО КАЛИБРА SAUER S 205 6 КАЛАШНИКОВ. ОРУЖИЕ, БОЕПРИПАСЫ, СНАРЯЖЕНИЕ 10/2005 Юрий Пономарёв Летом 2005 года фирма J. P. Sauer & Sohn GmbH выпустила в продажу представленную на IWA 2005 спортивную

Подробнее

пороха Размер зёрен (мм)

Порох метательное взрывчатое вещество, применяемое для сообщения снаряду движения. Охотничьи пороха подразделяются на две группы: 1. Механические селитро-сероуглеродные смеси (дымный порох). 2. Коллоидальные

Подробнее

СОВРЕМЕННОЕ. Ружьё 92 КАЛАШНИКОВ 12/2010 DWJ

СОВРЕМЕННОЕ Ружьё 92 КАЛАШНИКОВ 12/2010 DWJ Материал опубликован в 3/2010 русского издания DWJ. Подписка на WWW.KALASHNIKOV.RU Вскидка, поводка, выстрел Спортивная стендовая стрельба необычайно привлекательный

Подробнее

Профили стволов ГЕОМЕТРИЯ ИМЕЕТ ЗНАЧЕНИЕ

ГЕОМЕТРИЯ ИМЕЕТ ЗНАЧЕНИЕ Компания «Беретта» по праву считается крупнейшим в мире производителем стволов. Ни один производитель в мире не уделяет такого серьёзного внимания выбору стали. Steelium это технология

Подробнее

Удачной Вам охоты! Компания POZIS.

I ФГУП ПО «Завод имени Серго» (компания ) — ведущее предприятие оборонного комплекса РФ. На протяжении нескольких десятилетий компания является одним из основных поставщиков боеприпасов для Министерства

Подробнее

РУЖЬЕ ОХОТНИЧЬЕ ОДНОСТВОЛЬНОЕ ИЖ-18МН

РУЖЬЕ ОХОТНИЧЬЕ ОДНОСТВОЛЬНОЕ ИЖ-18МН Паспорт ЕИФЮ 776314.002 ПС 1 ВВЕДЕНИЕ 1.1 Приступая к эксплуатации ружья, внимательно изучите паспорт. Настоящий паспорт знакомит с основными техническими характеристиками,

Подробнее

Heym 26В лёгкий и крепко спаянный

Вольфрем Осджиен Heym 26В лёгкий и крепко спаянный На свой 140-летний юбилей фирма Heym подготовила великолепный штуцер с вертикальным расположением стволов. Лёгкий и удобный в обращении, с ручным взводителем

Подробнее

Лаборатория стрелкового оборудования

Лаборатория стрелкового оборудования Руководителю спортивной организации Уважаемые коллеги. Предприятие ООО «Экспрессавто» специализируется на поставке спортивного оборудования и инвентаря для обеспечения

Подробнее

Главное, что отличает карабин

«CОБОЛЬ» Ижевский В отличие от гладкоствольного оружия, в общем-то, универсального по своему назначению, нарезное значительно более узкоспециализированное. Фактически каждому объекту охоты соответствует

Подробнее

В преддверии юбилея. история \ \ автомат

В преддверии юбилея К юбилею Михаила Тимофеевича Калашникова наш журнал, носящий имя Главного Конструктора стрелкового оружия России, начинает публикацию материалов, посвященных его творчеству. А чтобы

Подробнее

Выбор охотничьего дробового ружья

ЦЕНТРАЛЬНЫЙ СОВЕТ ВСЕАРМЕЙСКОГО ВОЕННО-ОХОТНИЧЬЕГО ОБЩЕСТВА Волохов А.Н. Выбор охотничьего дробового ружья ВОЕННОЕ ИЗДАТЕЛЬСТВО МИНИСТЕРСТВА ВООРУЖЕННЫХ СИЛ СОЮЗА ССР, Москва 1949 А. Н. Волохов. Выбор охотничьего

Подробнее

REMINGTON 700 BDL DE LUX

В КАЛИБРЕ.243 WIN В последнее время среди российских охотников широкое распространение получила трофейная охота. Причем наши соотечественники уже не ограничиваются только охотничьими угодьями России, а

Подробнее

Приклад и цевье на Иж 43кн курковка.

Выберите странуРоссияАвстралияАвстрияАлбанияАлжирАнголаАнтарктидаАнтигуа и БарбудаАргентинаАрменияАрубаАфганистанБагамские островаБангладешБарбадосБахрейнБеларусьБелизБельгияБермудские о-ваБирмаБолгарияБоливияБосния и ГерцеговинаБотсванаБразилияБрунейБуркина-ФасоБурундиВануатуВеликобританияВенгрияВенесуэлаВиргинские островаВьетнамГайанаГанаГваделупаГватемалаГвинея-БисауГерманияГибралтарГонконгГренадаГренландияГрецияГрузияГуамДанияДжибутиДоминиканская РеспубликаЕгипетЗамбияЗападная СахараЗимбабвеЙеменИзраильИндияИндонезияИорданияИракИранИрландияИсландияИспанияИталияКабо-ВердеКазахстанКамбоджаКамерунКанадаКатарКенияКипрКиргизияКирибатиКитайКолумбияКонгоКорея ЮжнаяКубаКувейтЛаосЛатвияЛесотоЛиберияЛиванЛивияЛитваЛихтенштейнЛюксембургМаврикийМадагаскарМакедонияМалавиМалайзияМалиМальдивыМальтаМароккоМексикаМикронезияМозамбикМолдоваМонакоМонголияНамибияНауруНепалНигерНигерияНидерландыНикарагуаНовая ЗеландияНовая КаледонияНорвегияОбъединенные Арабские ЭмиратыОманПакистанПанамаПапуа — Новая ГвинеяПарагвайПеруПольшаПортугалияПуэрто-РикоРуандаРумынияСальвадорСанкт-ЛюсияСан-МариноСаудовская АравияСвазилендСейшельские островаСенегалСен-Пьер и МикелонСент-Китс и НевисСербияСингапурСирияСловакияСловенияСпратлиСуданСуринамСШАСьерра-ЛеонеТаджикистанТайваньТаиландТанзанияТобагоТокелауТонгаТринидадТувалуТунисТуркменистанТурцияУгандаУзбекистанУкраинаУругвайУэльсФарерские островаФиджиФилиппиныФинляндияФолклендские островаФранцияФранцузская ГвианаФранцузская ПолинезияХорватияЦентрально-Африканская РеспубликаЧадЧехияЧерногорияЧилиШвейцарияШвецияШотландияШпицбергенШри ЛанкаЭквадорЭритреяЭстонияЭфиопияЮжная АфрикаЮжная ДжорджияЯмайкаЯпония

Выберите категориюОружиe   Охотничьий      Гладкоствольные      Нарезные      Kомбинированные   Спортивные      Пистолеты      Винтовки   Боевые и служебные      Пистолеты      Автоматы      Снайперские винтовки   Обмундирование      Патроны         Охотничьи и спортивные            Дробовые            Пулевые            Пули            Гильзы            Дробь и картечь            Порох         Боевые и служебные            Пистолетные            Автоматные         Учебные   Метательные      Луки      Арбалеты      Рогатки      Аксессуары   Холодные клинковые      Ножи         Охотничьи и рыбацкие         Тактические         Выживания         Боевые         Метательные         Учебные      Мечи   Топоры   Инструменты для заточки   Газовые и травматические пистолеты      Патроны   Пневматические      Пистолеты         Охотничьий         Спортивные      Винтовки         Охотничьий         Спортивные      Газовые баллоны и пули      Для пейнтбола и страйкбола         Обмундирование   Сигнальные и охолощенные      Патроны   Ружья для подводной охоты   Тюнинг   Стрелковые тренажеры   Пулеуловители   Сейфы   Аксессуары      Мишени      Учебное оружие и боеприпасы      Баллистические гели      Уход за оружием      Чехлы, кобуры, кейсы, ящики      Ремни   Запчасти      Древесина         Стаблизированная      Композитные материалы и полимерыОптика   Прицельные мушки      Оптические      Коллиматорные      С лазерным дальномером      Цифровые      Голографические      Ночного видения   Бинокли   Зрительные трубы   Монокуляры   Увеличители   Телескопы   Лазерные дальномеры   Лазерные целеуказатели   Приборы ночного видения   Тепловизоры   Фонари   Холодная пристрелка   Баллистические калькуляторы   Крепления и аксессуарыВоенный   Снаряжение      Обмундирование      Аксессуары   Маскировочные сети   Грузовики   Военная списанная техника   Церемониальные пушкиТранспорт   Сухопутный      Вездеходы      Грузовики      Внедорожники      Квадроциклы      Мотоциклы      Велосипеды      Снегоходы      Автодома      Караваны      Прицепы      Снаряжение      Двигатели      Аксессуары      Запчасти   Воздушный      Вертолеты      Самолеты      Воздушные шары      Парапланы      Дельтапланы      Летающие аппараты      Парашюты      Снаряжение      Двигатели      Аксессуары      Запчасти   Водный      Суда         Яхты         Катера         На воздушных подушках      Лодки         Каяки, Байдарки         Каноэ         Весла      Гидроциклы      Хаусботы      Снаряжение      Тележки      Двигатели      Аксессуары      ЗапчастиБезопасность   Досмотровое оборудование      Металлодетекторы      Средства визуального досмотра      Аксессуары   Охранно-пожарные системы   Системы видеонаблюдения   Системы контроля доступа   Средства индивидуальной защиты      Бронезащита         Бронепанели         Бронежилеты         Бронекаски         Бронепапки      Аэрозоли      Электрошокеры      Дубинки      Наручники      Защита конечностей и суставов      Щиты      Наушники      Защитные очки      Противогазы и комплектующие      Респираторы      Костюмы изолирующие   Охранная экипировка   Тактическая медицинаОтдых и спорт   Активный отдых      Охотничьий         Снаряжение            Маскировка         Вышки         Засидки         Аксессуары         Собаки            Аксессуары      Рыбалка         Снаряжение         Удочки         Катушки         Поплавки         Грузики         Крючки         Карабины         Удилища         Приманки         Лески         Сети         Эхолоты         Сигнализаторы         Аксессуары            Чехлы, сумки, кейсы, ящики      Дайвинг      Палатки      Рюкзаки      Тактические сумки      Часы      Лыжи      Снегоступы      Лазертаг      Снаряжение         Походное            Спальные мешки            Кемпинговая мебель            Инструменты               Тактические лопаты            Обогреватели и печи            Газовое оборудование            Охладители            Посуда            Термосы            Фонари            Очки            Треккинговые палки         Альпинизма и скалолазания         Лавинное         Пейнтбольное и страйкбольное      Генераторы      Аксессуары   Спорт      Боевые искусства      Тренажеры      Фитнес      Одежда      Обувь      Защита и экипировка      АксессуарыОборудование   Средства связи      Радиостанции      Спутниковые телефоны      Мобильные телефоны для экстрима   Навигационное оборудование   Летающие аппараты   Роботы   Для экстрима   Аксессуары   Камеры      Фото      Видео      Аксессуары   АккумуляторыЭкзотические   Животные   Птицы   Рыбы   Вольеры   Tеррариумы и аквариумы   Животное сырье      Чучело      Мех      Шкура      Скелет         Череп         Кость         КлыкСувениры   Картины и рамки   Металлические      Золотые      Серебряные      Другое   Деревянные   Кожаные   Каменные   Резиновыe   Пластмассовые   Стеклянные   MоделиТематическая литература и видеоВоенныйБезопасность   Компании   Учебные центрыЭкспоЭкстремальный отдых   Туризм      Компании      Туры   Места для охоты   Места для рыбалки   Полеты и Прыжки      Дельтапланеризм      Парапланеризм   Езда   Дайвинг   Кайтбординг

  1. Частное лицо 
  2. Организация 
  1. Продается 
  2. Ищется 
  3. Обменяется
Валюта
  1. $
  2. £
Быстрый поиск Расширенный поиск

Ружье Байкал ИЖ-43 12 | Аукцион Rock Island

1. УСЛОВИЯ ПРОДАЖИ. Следующие условия продажи представляют собой полные условия, на которых предметы, перечисленные в каталоге аукционной компании Rock Island (далее именуемой «РССМД»), на веб-сайте в Интернете и в приложениях, будут предлагаться к продаже или продаваться РСМД. Все участники торгов, участвующие в торгах на этом аукционе, соглашаются с условиями продажи и соглашаются соблюдать их. Любые уведомления, опубликованные или устные во время продажи, также являются частью наших условий договора купли-продажи.Принятие карты участника торгов или номера участника торгов означает принятие следующих условий продажи. Права покупателя и соответствующие права и обязанности РСМД по настоящему Соглашению регулируются законодательством штата Иллинойс. Делая ставки на аукционе РСМД лично или через агента, запечатанные ставки, ставки по телефону, через Интернет или другими способами, покупатель или участник торгов соглашается с тем, что договор, созданный настоящими условиями продажи, заключен и исполняется в графстве Рок-Айленд, штат Иллинойс, и далее соглашается с тем, что в случае возникновения каких-либо споров по настоящему контракту юрисдикцией для разрешения споров по контракту является округ Рок-Айленд, штат Иллинойс.АУКЦИОНЕР НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА КАКИЕ-ЛИБО ОШИБКИ ПОКУПАТЕЛЯ, ВКЛЮЧАЯ, ПОМИМО ПРОЧЕГО, ЗАПОЛНЕНИЕ ПОКУПАТЕЛЕМ НЕПРАВИЛЬНОГО ЛОТА.

2. ПРЕМИЯ ПОКУПАТЕЛЯ. Все цены предложения «цены с молотка» («цены с молотка» означают цену, по которой лот сбивается покупателю) облагаются премией покупателя в размере 18,5%, уплачиваемой покупателем. Премия покупателя снижается до 15% при условии оплаты наличными или эквивалентом наличных денег (кассовым чеком, банковским переводом или одобренным личным чеком).Если счет оплачивается кредитной картой, премия покупателя будет составлять стандартные 18,5%. Это не совокупный процент от общей ставки по товарам, а процентная ставка по каждому товару. Кроме того, если покупатель использует платформу РСМД для торгов в режиме реального времени «RIAC Live», к премии покупателя будет добавлен дополнительный 1% от цены молотка. Премия, которая включает в себя дополнительный 1%, если покупатель использует платформу РСМД для торгов в режиме реального времени «RIAC Live», добавляется к выигравшей ставке покупателя, и обе суммы вместе составляют общую цену покупки.РСМД уполномочен грузоотправителем удерживать в составе вознаграждения РСМД премию покупателя, которая включает в себя дополнительный 1% от цены молотка, если покупатель использует платформу РСМД для торгов «RIAC Live», подлежащую уплате покупателем.

3. НАЛОГ С ПРОДАЖ.

RIAC является Координатором торговой площадки (как определено в применимых правилах для каждого штата) в целях сбора и представления налога с продаж для каждого применимого штата. Координатор торговой площадки — это компания, которая заключает контракты с продавцами для облегчения продажи материальных товаров и управляет всеми аспектами сделки.Координатор торговой площадки обязан взимать налог с продаж с покупателя и перечислять этот налог с продаж в штат, в который товары отправляются. Налог на продажу основан на адрес корабля. Если товар забирается с объекта РСМД или отправляется по адресу штата Иллинойс, взимается налог с продаж штата Иллинойс в размере 8,5%. Как правило, все элементы, включенные в счет-фактуру, облагаются налогом.

Для установления безналоговой продажи копия действительного разрешения торгового посредника или другой документ или информация, устанавливающая освобождение от налога с продаж, в соответствии с требованиями применимого штата, должна быть предоставлена ​​в соответствии с требованиями РСМД.Пожалуйста, посетите наш веб-сайт, rockislandauction.com, для получения дополнительной информации о сертификатах перепродажи. Любой покупатель, претендующий на освобождение от налога с продаж, но не способный предоставить в РСМД удовлетворительные доказательства на момент оплаты, будет обязан уплатить соответствующий налог в РСМД, а затем потребовать возмещения от соответствующего штата. Покупатель соглашается уплатить РСМД фактическую сумму налога, если при совершении покупки по какой-либо причине была уплачена неправильная сумма налога с продаж.

Налог с продаж необходимо взимать и перечислять во всех штатах, кроме следующих:

Штаты без налога с продаж: Аляска (некоторые города, округа и районы требуют, чтобы РСМД собирал налог с продаж), Делавэр, Монтана, Нью-Гэмпшир и Орегон.

Штат без налога с продаж для организаторов торговой площадки: Миссури (до 01.01.2023) .

Другое:  Округ Колумбия (округ Колумбия) — RIAC не соответствует пороговым значениям, требующим взимания налога с продаж.

4. СПОСОБ ОПЛАТЫ. Продажа на аукционе строго за наличный расчет, кассовый чек, именные чеки (с предварительного согласования с руководством РСМД), MasterCard, Visa, AMEX или Discover. ПРИМЕЧАНИЕ ДЛЯ ИНОСТРАННЫХ ПОКУПАТЕЛЕЙ. Способ оплаты: валюта США, заверенный чек, выписанный в американском банке, или банковский перевод.

5. УСЛОВИЯ ОПЛАТЫ. При объявлении «ПРОДАНО» предложенный лот приобретет тот, кто предложит самую высокую цену. Все продажи считаются окончательными при падении молота аукциониста или при объявлении «ПРОДАНО». Покупка осуществляется в соответствии со всеми условиями, изложенными в настоящем документе. Покупатель берет на себя полную ответственность за это и, если потребуется, подпишет подтверждение покупки. Покупатель также соглашается оплатить общую сумму к оплате. Общая сумма, подлежащая уплате, должна быть полностью оплачена в день продажи, если вы присутствуете лично, в противном случае — после получения счета-фактуры покупателя.Все имущество должно быть вывезено из помещения РСМД за счет покупателя не позднее 17:00. через пять дней после даты продажи, если не оговорено иное. Если имущество не вывезут, оно будет храниться на территории РСМД за 50 долларов в месяц. В этом случае покупатель не сможет забрать купленные лоты до тех пор, пока РСМД не будет оплачена плата за хранение. Если купленные партии не будут забраны, а сборы за хранение не оплачены РСМД, товары будут проданы в соответствии с Законом Иллинойса об удержании труда и хранении, 770 ILCS 45/0.01 и след. и/или 770 ILCS 50/0,01 и след.

Каждый покупатель на данном аукционе предоставляет РСМД залог в приобретаемом имуществе. Любое имущество покупателя и все денежные средства, находящиеся во владении или полученные РСМД от имени покупателя, будут сохранены в качестве залога по обязательствам покупателя перед РСМД. РСМД может использовать по таким обязательствам денежные средства, удерживаемые или полученные РСМД за счет или причитающиеся покупателю. РСМД сохраняет за собой все права обеспеченной стороны в соответствии с Коммерческим кодексом штата Иллинойс.Всякий раз, когда покупатель оплачивает только часть Общей суммы задолженности за один или несколько приобретенных лотов, РСМД может по собственному усмотрению применить такие платежи к лоту или лотам, выбранным РСМД. Оплата не будет считаться произведенной в полном объеме до тех пор, пока РСМД не получит все причитающиеся суммы наличными или денежными средствами. РСМД по своему усмотрению определяет, что считать хорошими фондами. В случае, если Покупатель оплачивает чеком и чек возвращается из-за недостаточности средств, остановки платежа, закрытия счета или по любой другой причине, и Покупатель уже владеет имуществом, такое владение имуществом будет считаться кражей путем обмана и /или кража до 18 лет.SC § 922(u), что может повлечь за собой наказание в виде штрафа в размере до 250 000 долларов США, лишения свободы в федеральной тюрьме на срок до 10 лет или и того, и другого. В дополнение к средствам правовой защиты, доступным РСМД и грузоотправителю по закону, в случае несоблюдения покупателем условий продажи (включая, но не ограничиваясь выплатой в полном объеме Причитающейся суммы), РСМД по своему усмотрению может: (1) отменить продажу и сохранить в качестве заранее оцененных убытков все платежи, произведенные покупателем; или (2) перепродать имущество публично или в частном порядке, и в таком случае покупатель несет ответственность за выплату недостающей суммы плюс все затраты и расходы как по продаже, так и комиссию РСМД за обе продажи по стандартным ставкам РСМД, а также как и любой другой ущерб, включая, помимо прочего, упущенную выгоду.Покупатель настоящим отказывается от любых уведомлений о продаже, требуемых Коммерческим кодексом штата Иллинойс. Покупатель также несет ответственность за все другие расходы, причитающиеся по настоящему Соглашению, в дополнение к любым гонорарам адвокатов, понесенным РСМД, случайным убыткам и любым другим убыткам, понесенным РСМД.

6. ПРОЦЕНТЫ И НЕИСПОЛНЕНИЕ. Оплата общей суммы должна быть произведена после получения счета-фактуры от покупателя. Если сумма, указанная в счете-фактуре покупателя, не будет оплачена полностью в течение 15 дней после аукциона, РСМД имеет право и спишет с кредитной карты покупателя полную сумму счета-фактуры.Проценты будут начисляться на все невыплаченные остатки по ставке 1-1/2% в месяц (18% годовых) или по максимальной допустимой ставке в соответствии с законодательством штата Иллинойс, в зависимости от того, что ниже, начиная с 15 дней после даты покупки/аукциона. Покупатель признает, что в случае несоблюдения покупателем какого-либо из условий продажи, включая оплату полной суммы, указанной в счете-фактуре покупателя, убытки, понесенные РСМД, включают, помимо прочего, комиссию комитента, потерю возможности использования денег за на неопределенный срок, затраты на повторное выставление предмета на продажу и возможное обесценивание предмета, а также убытки, возникающие при перепродаже лота, независимо от того, известны ли такие убытки в настоящее время или могут стать известны в будущем.Соответственно, в случае, если покупатель не уплатит полную сумму, указанную в счете покупателя, в течение 45 дней после аукциона, покупатель несет немедленную ответственность за заранее оцененные убытки в размере, равном 30% суммы, указанной в счете покупателя. Эти заранее оцененные убытки добавляются к общей сумме, указанной в счете-фактуре покупателя, и любым применимым процентам. РСМД будет удерживать любые деньги, депонированные в счет частичного платежа, в счет любого обязательства по дефолтному объекту и будет использовать их по собственному усмотрению РСМД для погашения непогашенной задолженности.

7. ВЫВОД. РСМД оставляет за собой право снять любое имущество с аукциона до продажи.

8. ПРОТЕСТЫ, СПОРЫ И АКЦИОНЕР. РСМД оставляет за собой право отклонить заявку любого участника. Покупателем будет признанный аукционистом участник, предложивший самую высокую цену. Аукционист имеет единоличное и окончательное усмотрение в отношении разрешения любого спора, включая повторное предложение и перепродажу любого оспариваемого предмета. Записи РСМД будут считаться окончательными во всех отношениях в случае возникновения каких-либо споров после продажи.

9. НЕДОСТАВКА ИМУЩЕСТВА ПОКУПАТЕЛЯ. Если РСМД не может передать какое-либо имущество покупателю из-за пожара, кражи или по любой другой причине, ответственность РСМД ограничивается суммой, фактически уплаченной покупателем, и ни в коем случае не включает любые случайные или косвенные убытки.

10. ГАРАНТИЯ. Вся недвижимость, выставленная на продажу, находится в том виде, в каком она есть. ВСЕ ПРОДАЖИ ОКОНЧАТЕЛЬНЫ. ВОЗВРАТА И ОБМЕНА НЕ БУДЕТ. РСМД не дает и не дает гарантий ни на один проданный лот.Описания в каталоге являются мнением. Они написаны в качестве помощи для потенциальных участников. РСМД признает, что в написанном могут быть ошибки. РСМД настоятельно рекомендует вам лично просматривать любой лот, на который вы делаете ставку, или привлекать к просмотру лота признанного эксперта. РСМД не будет нести никаких обязательств, т. е. возмещение или возврат не принимаются, если вышеуказанные условия не выполняются. Предметы, предлагаемые для продажи в соответствии с описанием в каталоге или любом чеке, рекламе, дополнительном листе или где-либо еще в отношении авторства, периода, культуры, источника, происхождения, размера, качества, редкости, происхождения, важности, выставки или физического состояния, являются квалифицированные заявления мнения, а не заверения или гарантии.Ни один сотрудник РСМД или любое лицо, имеющее целью действовать от имени РСМД, не уполномочен делать от имени РСМД или грузоотправителя какие-либо заверения или гарантии, устные или письменные, в отношении любого лота или предмета, выставленного на продажу.

11. ОБЯЗАТЕЛЬНОЕ ВЛИЯНИЕ, МОДИФИКАЦИИ И РАЗДЕЛИМОСТЬ. Условия продажи являются обязательными для правопреемников и правопреемников всех участников торгов и покупателей и действуют в интересах правопреемников и правопреемников РСМД. Никакие отказы, поправки или модификации условий настоящего Соглашения (кроме размещенных уведомлений или устных объявлений во время продажи) не являются обязательными для РСМД, если это прямо не указано в письменной форме и не подписано РСМД.Если какая-либо часть этих условий продажи по какой-либо причине недействительна или не имеет законной силы, недействительная часть должна быть исключена, а остальные положения и условия продажи останутся в силе и подлежат исполнению.

12. РЕЗЕРВЫ. На некоторые лоты на этом аукционе может распространяться резерв (конфиденциальная минимальная цена, ниже которой лот не будет продан). Если лот предлагается с резервом, РСМД может реализовать этот резерв путем проведения торгов от имени отправителя. Не допускается наличие резерва выше верхней оценки, а во многих случаях резерв ниже нижней оценки.Эти торги, как правило, не являются вступительными торгами. Если РСМД объявит стартовую ставку и не будет получен аванс к этой ставке, РСМД пропустит этот пункт. Однако после открытия торгов РСМД будет предлагать цену от имени грузоотправителя для достижения резервной цены. Аукционист может отклонить номинальные ставки, которые представляют собой небольшие начальные ставки или очень номинальные авансы, сделанные с целью обесценивания предмета. Если по лоту не удается получить ставку, равную или превышающую 25–30% от минимальной оценки, лот может быть принят и не продан, и не может быть повторно предложен до более поздней продажи.Решение о том, продавать ли предмет на текущем аукционе или повторно предлагать его на более позднем аукционе, остается на усмотрение аукциониста. РСМД закупает товары на открытом рынке или может предоставить гарантию грузоотправителю. В любом случае РСМД может иметь право собственности или иной финансовый интерес в предмете (предметах), выставленном на аукцион. Такой интерес к предмету(ам), выставленному на аукцион, не может быть раскрыт. Если у РСМД есть интерес к предложенному лоту и доходам от него, помимо нашей комиссии, РСМД может подать заявку на предложенный лот для защиты такого интереса, и такие торги не должны быть запрещены в соответствии с разделом 13 ниже.Предметы, которые не зарезервированы, продаются по усмотрению организатора аукциона.

13. ПРЕДЛОЖЕНИЯ ГРУЗООТПРАВИТЕЛЕЙ. Грузоотправителям, за исключением РСМД, не разрешается делать ставки на свои собственные товары, а также иметь агентов, делающих ставки от их имени. Если Аукционист узнает о таких торгах или ему сообщают об этом, Аукционист оставляет за собой право изъять любые или все предметы, отправленные нарушившим отправителем. В соответствии с настоящим разделом 13 не запрещено поведение, когда аукционист делает ставки от имени грузоотправителя для достижения начальной цены, как указано в разделе 12 выше.

14. ФИНАНСОВАЯ ЗАИНТЕРЕСОВАННОСТЬ В ИМУЩЕСТВЕ. Покупатель признает, что РСМД имеет финансовую заинтересованность во всех предметах, выставленных на продажу, поскольку ему выплачивается комиссия продавца и премия покупателя. Кроме того, Покупатель признает, что может существовать конфликт интересов, поскольку РСМД, его должностные лица или сотрудники или организация, принадлежащая одному или нескольким из них, могут иметь финансовую заинтересованность в предмете, предлагаемом для продажи, помимо комиссии продавца и премии покупателя, что может включать долю владения или гарантированную сумму, предлагаемую РСМД комитенту объекта для продажи.

15. ЗАОЧНЫЕ ТОРГИ. В качестве услуги для всех, кто желает подать заявку до начала торгов, РСМД может принимать заявки от имени потенциальных участников торгов по собственному усмотрению РСМД по телефону или запечатанной заявкой с использованием форм, предоставляемых РСМД. Запечатанная заявка должна быть получена и утверждена на кредит до даты продажи. Ответственность за установление кредита перед торгами лежит на Участнике торгов, в противном случае РСМД примет 15% предоплату от общей суммы поданных заявок. (Депозиты будут возвращены в течение десяти (10) дней после продажи, если они не будут успешными.) Форма закрытой заявки прилагается в конце каталога. Предложения можно также отправить по факсу (309) 797-1655. Кроме того, онлайн-торги доступны на сайте РСМД. Покупатели признают, что при проведении заочных торгов по почте, электронной почте, телефону, через интернет-провайдеров или любым другим заочным способом (т. е. не при личном участии в торгах) между участником торгов и РСМД не возникает никаких фидуциарных обязательств. Покупатель признает, что РСМД несет фидуциарные обязательства перед продавцами, а не перед участниками торгов или покупателями. Покупатель признает, что РСМД не обязан раскрывать информацию о праве собственности на какой-либо предмет, выставленный на аукцион.Любая заочная ставка выполняется так, как если бы участник действительно присутствовал и делал ставки сам. РСМД будет пытаться исполнять ставки таким образом, чтобы ставки имели преимущественную силу по минимально возможной ставке. РСМД не несет ответственности за непроведение торгов по телефону, в запечатанных или веб-сайтах/онлайн-заявках по какой бы то ни было причине, а также за непроведение торгов таким образом, что они не имеют преимущества при минимально возможной ставке.

16. ТЕЛЕФОННЫЕ ТОРГИ. Чтобы сделать ставку на лот по телефону во время его продажи, участник торгов должен заранее связаться с РСМД для согласования условий.Участник торгов должен связаться с РСМД до 14:00. день, предшествующий продаже, чтобы договориться о торгах по телефону. Если участник торгов обратится в РСМД после 14:00. за день, предшествующий продаже, РСМД не может гарантировать исполнение заявок участников торгов. Представитель РСМД свяжется с участником торгов в день продажи, до того, как запрашиваемый лот(ы) будут выставлены на продажу. Предложения по телефону можно отправить по факсу (309) 797-1655 или отправить через нашу онлайн-службу.

УЧАСТВУЯ В ТЕЛЕФОННЫХ ТОРГАХ, УЧАСТНИК И ПОКУПАТЕЛЬ ПОНИМАЮТ, ПОДТВЕРЖДАЮТ И СОГЛАСНЫ НА ЗАПИСЫВАЕМЫЙ ТЕЛЕФОННЫЙ РАЗГОВОР.

«Заявки с прикрытием». Как участник торгов по телефону помните, что существует риск того, что RIAC не сможет связаться с участником торгов по телефону. Поэтому участник торгов по телефону может захотеть разрешить своему представителю по телефону проводить торги от его или ее имени. Во время организации телефонных торгов участник телефонных торгов должен просто указать максимальные суммы, которые он или она готовы предложить по каждому лоту на тот случай, если РСМД не сможет связаться с участником телефонных торгов. Эта сумма используется только в том случае, если участник торгов по телефону не разговаривает по телефону со своим представителем.Предполагая, что с участником торгов по телефону можно связаться по телефону, представитель по телефону будет полагаться только на устные инструкции участника торгов по телефону. «Заявки на прикрытие» не являются обязательными, Участник торгов по телефону может размещать их по своему усмотрению. «Заявки с прикрытием» — это просто подстраховка на случай, если с участником торгов по телефону невозможно будет связаться вовремя или вообще не удастся связаться. Все условия, изложенные в Разделе 13 выше, применяются к любым «Заявкам с покрытием», включая, помимо прочего, все признания Покупателем и любое раскрытие информации об отсутствии каких-либо обязанностей со стороны РСМД.

Онлайн-торги доступны через сторонних поставщиков. Потенциальные участники торгов уведомляются о том, что эти сторонние сервисы взимают дополнительную надбавку покупателя сверх надбавки, взимаемой РСМД.

17. ЗАКОНЫ ОБ ОРУЖИИ. Все огнестрельное оружие после 1898 года должно быть зарегистрировано в соответствии с федеральным законом и законодательством штата Иллинойс. Покупатели огнестрельного оружия после 1898 года должны заполнить регистрационные формы штата и федерального уровня в аукционной компании Rock Island, 7819 42nd Street West, Rock Island, IL 61201, если не указано иное.3-дневный период ожидания является обязательным для современных пистолетов и современного длинноствольного оружия. Дилеры и покупатели за пределами штата должны иметь при себе в день продажи подписанные копии своей Федеральной лицензии на огнестрельное оружие (FFL), чтобы принять доставку современного оружия в тот же день. Покупатели, выступающие в качестве агентов дилеров FFL, должны иметь представительское письмо, а также подписанную копию FFL дилера.

18.  КЛАСС 3. Все огнестрельное оружие, относящееся к классу 3, должно быть зарегистрировано в соответствии с реестром NFA.После покупки все межгосударственные переводы осуществляются от РСМД дилеру класса 3, имеющему лицензию FFL/SOT, в вашем регионе. Плата за перевод с покупателя в это время не взимается. Когда передача одобрена, огнестрельное оружие отправляется дилеру класса 3. Затем дилер класса 3 подготавливает перевод формы 4 покупателю. В это время покупатель платит акцизный сбор в размере 200 долларов США. Единственные межгосударственные передачи, которые могут быть осуществлены физическому лицу, — это те, где у покупателя есть лицензия Curio & Relics, а приобретаемое огнестрельное оружие было классифицировано ATF как Curio & Relic NFA.Для подачи документов о переводе требуется уплата федерального налога в размере 200 долларов США. Эта плата, а также общая сумма к оплате должны быть уплачены во время покупки для обработки документов. Новый владелец огнестрельного оружия класса 3 должен будет заполнить 2 формы: 1) форму 4 ATF и 2) карту отпечатков пальцев. Эти формы будут предоставлены вам РСМД. Примечание: если закон штата или местный закон требует разрешения или лицензии на покупку, владение или получение огнестрельного оружия NFA, к заявке должна прилагаться копия разрешения или лицензии получателя (покупателя).Затем РСМД отправляет документы по федеральному трансфертному налогу в BATFE по почте. РСМД получит обратно одну из форм 4 (они отправляются в двух экземплярах) с прикрепленной к ней федеральной налоговой маркой. Он предоставляется новому владельцу при доставке огнестрельного оружия NFA. Никакой дополнительный налог не взимается. Пожалуйста, проверьте статус вашего штата перед тем, как сделать ставку или совершить покупку, чтобы убедиться, что вы имеете право владеть и владеть огнестрельным оружием класса III, поскольку законы продолжают меняться. СПЕЦИАЛЬНОЕ ПРИМЕЧАНИЕ. Если вы являетесь плательщиком SOT (специального оккупационного налога) (дилер класса 3), вы можете передавать исправное огнестрельное оружие NFA другим плательщикам SOT и государственным учреждениям или от них с одобрения BATFE, но без уплаты налога на передачу.РСМД не дает никаких гарантий и не делает заявлений о том, что вышеупомянутых форм, сборов, лицензий и/или разрешений будет достаточно для того, чтобы вы владели или использовали приобретенное огнестрельное оружие (оружие). Проконсультируйтесь с вашими федеральными, государственными и местными законами, сотрудниками правоохранительных органов или юристом, чтобы убедиться, что вы можете законно владеть, владеть или использовать приобретенное огнестрельное оружие (оружие) и что все сборы, лицензии и разрешения выполнены.

19. СОСТОЯНИЕ ОГНЕСТРЕЛЬНОГО ОРУЖИЯ. РСМД не дает никаких гарантий или заявлений, и ни один из сотрудников или консультантов РСМД не имеет полномочий делать иное в отношении условий стрельбы, пригодности к использованию, безопасности хранения или надежности любого огнестрельного оружия, боеприпасов или его частей.Использование любого огнестрельного оружия или боеприпасов, приобретенных в РСМД, полностью на риск пользователя. РСМД выставляет лоты на продажу только как «коллекционные». РСМД настоятельно рекомендует все оружие, боеприпасы и т.п., приобретаемые на аукционе, проверять у компетентного оружейника. РСМД прямо отказывается от какой бы то ни было ответственности за несчастные случаи, травмы или ущерб, причиненные любому лицу в результате хранения или последующего использования любой такой партии.

20. НАХОДЯЩИЕСЯ ИЛИ ОХРАНЯЕМЫЕ ВИДЫ ИЛИ ДИКИЕ ЖИВОТНЫЕ. Любая собственность, состоящая из исчезающих или охраняемых видов или диких животных, может иметь ограничения на импорт и экспорт, установленные Конвенцией о международной торговле видами дикой фауны и флоры, находящимися под угрозой исчезновения (CITIES).Эти товары недоступны для международной доставки, а в некоторых случаях и внутри страны. Кроме того, эти предметы могут быть конфискованы государственными или федеральными властями, если не будут представлены надлежащие документы, разрешающие их продажу. Размещая заявку, участник торгов подтверждает, что ему известно об ограничении, и он берет на себя ответственность за получение и оплату любых лицензий или разрешений, имеющих отношение к поставке предмета(ов). РСМД не несет ответственности за невозможность отправки приобретенных товаров или конфискацию таких товаров должностными лицами штата или федеральными властями до их отправки или транспортировки победителю торгов.

21. ОПЛАТА ДОСТАВКИ, ТРАНСПОРТИРОВКИ И ХРАНЕНИЯ. Все расходы по доставке, отгрузке и хранению должны быть оплачены победителем торгов до поставки огнестрельного оружия.

22. ДОСТАВКА. Если РСМД попросят отгрузить купленные лоты, за такую ​​доставку будет взиматься отдельная плата. Стоимость доставки будет зависеть от того, сколько стоит РСМД доставка купленных лотов покупателю. Если упаковка и обработка купленных лотов осуществляется РСМД, то это осуществляется исключительно на риск покупателя.Все товары должны иметь страховку доставки; эта страховка обязательна. Все посылки отправляются с обязательной подписью взрослого. РСМД не будет взимать оплату труда за доставку. РСМД не несет ответственности за какие-либо упущения при упаковке или доставке. Приобретенные партии, обрабатываемые сторонними перевозчиками или упаковщиками, в том числе рекомендованными РСМД, могут быть застрахованы по собственной страховке, и любые требования о возмещении убытков или повреждений должны быть адресованы непосредственно сторонним перевозчикам или упаковщикам. РСМД организует упаковку и отправку в кратчайшие сроки.РСМД постарается отправить как можно скорее; однако из-за большого количества заочных предложений РСМД доставка может занять до двух недель после получения полной оплаты. В случае обрешетки или какой-либо нестандартной упаковки с покупателя будет взиматься стоимость РСМД со сторонних агентов. Покупатель оплачивает доставку, упаковочные материалы и страховые сборы. РСМД оставляет за собой право приобрести страховку внешнего грузоотправителя, застраховаться самостоятельно или и то, и другое.

Партии боеприпасов будут отправлены только в FFL.При получении необходимо иметь FOID или FFL. Применяются все государственные и местные законы.

Доставка любых приобретенных товаров за пределы Соединенных Штатов настоящим классифицируется как «иностранный экспорт». Весь иностранный экспорт является исключительной ответственностью покупателя.

23. СПОРЫ ПО НАСТОЯЩЕМУ ДОГОВОРУ. Покупатель и РСМД соглашаются урегулировать любой спор или претензию, возникающие между ними в связи с участием покупателя в аукционе или любой связанной с ним сделкой, за исключением случаев неисполнения покупателем обязательств перед РСМД в полном объеме.В случае неуплаты покупателем РСМД полной суммы, РСМД может, но не обязан, обратиться непосредственно в суд. Кроме того, покупатель и РСМД соглашаются, что в случае необходимости посредничества расходы на посредничество, если таковые имеются, будут нести стороны в равных долях. В соответствии с условиями продажи покупатель и РСМД должны заключить соглашение о посредничестве до арбитража или любого судебного разбирательства. Если сторона инициирует судебный процесс, отличный от посредничества, без письменного уведомления другой стороны, сторона, инициирующая судебный процесс таким образом, не будет иметь права на возмещение гонораров адвоката, даже если в противном случае они были бы допущены к иску.Все посреднические, арбитражные и судебные разбирательства, будь то в суде штата или в федеральном суде, должны подаваться и проводиться исключительно в округе Рок-Айленд, штат Иллинойс, а не в какой-либо другой юрисдикции.

Если посредничество не урегулирует спор между сторонами, покупатель и РСМД соглашаются, что любой спор или претензия по закону или праву справедливости, возникающие в результате участия в аукционе или любой связанной с ним сделки, подлежат разрешению в нейтральном обязывающем арбитраже с использованием стандартов американского Арбитражной ассоциации и должно быть инициировано и проведено в округе Рок-Айленд, штат Иллинойс.Любой участник торгов или покупатель соглашается с тем, что решение о передаче любых исков в арбитраж является добровольным решением и подтверждается участием участника торгов или покупателя в аукционе. Покупатель, в частности, соглашается со следующим: я ознакомился с условиями продажи и, участвуя в этой продаже, я соглашаюсь, что все споры, возникающие в результате моего участия, будут сначала переданы в Посредничество, и если Посредничество не увенчается успехом в разрешении спора. Затем я подаю на нейтральное обязывающее арбитражное разбирательство с РСМД и любой другой организацией в соответствии с настоящим договором.Ни один иск не может быть подан до тех пор, пока лицо добросовестно не завершит все процедуры посредничества и арбитража, как того требует настоящее Соглашение.

24. ОГРАНИЧЕНИЕ ОТВЕТСТВЕННОСТИ. ЗА ИСКЛЮЧЕНИЕМ СЛУЧАЕВ, УКАЗАННЫХ ВЫШЕ, ВСЕ ИМУЩЕСТВО ПРОДАЕТСЯ «КАК ЕСТЬ». НИ КОМПАНИЯ ROCK ISLAND AUCTION, НИ ГРУЗОВОЗДАТЧИК НЕ ПРЕДОСТАВЛЯЮТ КАКИХ-ЛИБО ЗАЯВЛЕНИЙ ИЛИ ГАРАНТИЙ, ЯВНЫХ ИЛИ ПОДРАЗУМЕВАЕМЫХ, В ОТНОШЕНИИ НАЗВАНИЯ, ПРИГОДНОСТИ ДЛЯ ПРОДАЖИ, ПРИГОДНОСТИ ИЛИ СОСТОЯНИЯ ИМУЩЕСТВА, ИЛИ В ОТНОШЕНИИ ПРАВИЛЬНОСТИ ОПИСАНИЯ, ПОДЛИННОСТИ, АТРИБУЦИИ, ПРОИСХОЖДЕНИЯ ИЛИ ПЕРИОДА СОБСТВЕННОСТИ В ОТНОШЕНИИ ПРИОБРЕТЕНИЯ ПОКУПАТЕЛЕМ КАКИХ-ЛИБО АВТОРСКИХ ПРАВ ИЛИ ДРУГИХ ПРАВ ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ НА ПРОДАВАЕМЫЕ ПАРТИИ, ИЛИ В ОТНОШЕНИИ, ПОДХОДИТ ЛИ ПРОИЗВЕДЕНИЕ ХУДОЖНИКА МОРАЛЬНЫЕ ПРАВА ХУДОЖНИКА ИЛИ ДРУГИЕ ОСТАТОЧНЫЕ ПРАВА ХУДОЖНИКА.ВСЕ ОРУЖИЕ И БОЕПРИПАСЫ ПРОДАЮТСЯ ТОЛЬКО КОЛЛЕКЦИОННЫМИ ПАРТИЯМИ. ROCK ISLAND AUCTION COMPANY ЯВНО ОТКАЗЫВАЕТ ПРИГОДНОСТЬ СТРЕЛЯТЬ ИЛИ ИНЫМ ОБРАЗОМ РАЗРЯДИТЬ ОРУЖИЕ ИЛИ БОЕПРИПАСЫ. ПЕРЕД ПОПЫТКОЙ ИСПОЛЬЗОВАНИЯ ИЛИ ВЫСТРЕЛА ИЗ ЛЮБОГО ОРУЖИЯ ИЛИ БОЕПРИПАСОВ СЛЕДУЕТ ПРОКОНСУЛЬТИРОВАТЬСЯ С КОМПЕТЕНТНЫМ ОРУЖЕЙНИКОМ. ПОКУПАТЕЛЬ ПРЯМО ПРИЗНАЕТ И СОГЛАШАЕТСЯ С ТЕМ, ЧТО ROCK ISLAND AUCTION COMPANY НИ ПРИ КАКИХ ОБСТОЯТЕЛЬСТВАХ НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА ЛЮБОЙ УЩЕРБ, ВКЛЮЧАЯ, ПОМИМО ПРОЧЕГО, ЛЮБЫЕ КОМПЕНСАЦИОННЫЕ, СЛУЧАЙНЫЕ ИЛИ КОСВЕННЫЕ УБЫТКИ.

ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ: Аукционная компания Rock Island не гарантирует подлинность каких-либо предметов немецкой армии, продаваемых на аукционах, посвященных Дню спорта и коллекционирования и Оружия и аксессуаров.Все немецкие военные предметы, описанные в каталоге аукционов Sporting & Collector и Arms & Accessories Day Auctions, должны рассматриваться как предметы после Второй мировой войны, и поэтому участникам торгов настоятельно рекомендуется делать соответствующие ставки.

Байкал Mdl ИЖ-43 12 калибра, 2 3/4″ SN:0212363B Двуствольное ружье полевого класса SXS российского производства. или подразумевается в отношении состояния, подлинности или эпохи любого описанного предмета.Все предметы предлагаются для продажи тому, кто предложит самую высокую цену, и участники торгов должны убедиться в их подлинности и состоянии перед началом торгов. Все продажи являются окончательными, никаких возвратов, никаких исключений. Специальное положение для покупателей из Калифорнии, пожалуйста, ознакомьтесь с законами вашего штата. На этом аукционе есть несколько видов оружия, которые разрешены в Калифорнии, но магазины не разрешены. Также посетите веб-сайт CA DOJ, чтобы ознакомиться со списком пистолетов, сертифицированных для продажи, а также со списком Curio and Relics. ЭТО ВАША ОТВЕТСТВЕННОСТЬ КАК ПОКУПАТЕЛЯ.Спасибо аукционам Reata Pass.

Все предметы, выставленные на продажу на этом аукционе, будут выставлены на продажу только на аукционе, без предпродаж.

Аризона Налог с продаж уплачивается всеми покупателями, подлежащими налогообложению. Все дилеры должны предоставить действительный номер перепродажи при регистрации и заполнить карточку перепродажи штата Аризона до подачи заявки на освобождение от налогов.

Все ставки указаны по номеру в каталоге, и все товары будут продаваться только по порядку номеров. Зарезервировано право на розыгрыш любого предмета или лота до продажи.Абсолютно ни один лот не будет разбит.

Победит тот, кто предложит самую высокую цену. Аукционист будет регулировать торги и оставляет за собой право отклонить любую ставку, которая не считается добросовестной. В случае возникновения каких-либо споров между участниками аукциона решение аукциониста в отношении победителя торгов будет окончательным. Кроме того, аукционист может повторно предложить или перепродать любой спорный лот.

Со всех продаж взимается премия покупателя в размере 17%.

Аукционист или Аукционный дом не несет ответственности за ошибки в каталоге, рекламе или со стороны участника торгов.

Все товары, приобретенные победителем торгов, должны быть оплачены в день продажи. Покупки, не оплаченные в течение 14 дней с даты окончательной продажи, будут облагаться штрафом за просрочку платежа в размере 5%, по всем просроченным счетам будут начисляться проценты по ставке 1,5% в месяц на невыплаченный остаток и начисляться ежемесячно. Хранение будет предоставляться бесплатно в течение 14 дней после даты продажи, а затем по ставке 5 долларов США за единицу в день, если не были достигнуты предварительные договоренности. Доставка является обязанностью Покупателя, и Покупатель должен принять все меры по отгрузке или доставке крупногабаритных товаров.Небольшие товары будут упакованы и отправлены нами за счет покупателя. Мы не взимаем плату за создание и доставку мелких деталей, кроме точной стоимости. Страхование груза является обязанностью Покупателя.

Все предметы для продажи на аукционе предлагаются «КАК ЕСТЬ», и АУКЦИОНЕР ИЛИ АУКЦИОННЫЙ ДОМ НЕ НЕСЕТ НИКАКОЙ ОТВЕТСТВЕННОСТИ ЗА ПОЛОМКИ ИЛИ ПОВРЕЖДЕНИЯ ПОСЛЕ ПАДЕНИЯ МОЛОТОЧКА. ПРИНЯТИЕ ЗАЯВКИ АКЦИОНЕРОМ ПРЕДСТАВЛЯЕТ СОБОЙ ЮРИДИЧЕСКИЙ И ОБЯЗАТЕЛЬНЫЙ КОНТРАКТ С ПОКУПАТЕЛЕМ И ПРИНЯТИЕ УСЛОВИЙ ПРОДАЖИ В СООТВЕТСТВИИ С ЗАКОНОМ ШТАТА АРИЗОНА.

Все огнестрельное оружие Post 1898 подлежит регистрации и должно быть зарегистрировано в соответствии как с законами Аризоны, так и с федеральными законами. Покупатели огнестрельного оружия Post 1898 должны заполнить все необходимые регистрационные формы в Auction Productions Ltd., 3525 South Hwy 69, Humboldt, Arizona. Телефон 928-632-8000. Дилеры в Аризоне должны иметь в своем распоряжении в день продажи подписанные копии своей Федеральной лицензии на огнестрельное оружие, чтобы принять доставку современного оружия в тот же день. Доставка для покупателей из других штатов должна быть организована через аукционную компанию и должна быть отправлена ​​действительному держателю федеральной лицензии на огнестрельное оружие на все современное оружие.Стоимость доставки и упаковки будет за счет покупателя.

Аукционист или Аукционная компания не дает никаких гарантий в отношении работы или условий стрельбы из любого оружия, выставленного на продажу. Рекомендуется, чтобы все оружие, купленное на аукционе, было проверено компетентным оружейником, прежде чем пытаться стрелять из него.

Грузоотправителям не разрешается делать ставки на собственные товары, а агенты не могут делать ставки от их имени. Если организатор аукциона узнает о таких торгах или будет уведомлен об этом, он может отозвать любой или все лоты, переданные правонарушителем, и публично признает этого отправителя.

Аукционист/Аукционный дом «НЕ НЕСЕТ ОТВЕТСТВЕННОСТИ ЗА НЕСЧАСТНЫЕ СЛУЧАИ».

Reata Pass Auctions подтверждает стандарты NRA Отчета об условиях. СТАНДАРТЫ СОСТОЯНИЯ СОВРЕМЕННОГО ОРУЖИЯ NRA:

НОВИНКА: ранее не продавалась в розницу, в том же состоянии, что и текущее заводское производство.

ИДЕАЛЬНО: Новое состояние во всех отношениях. (Примечание Джима: по моему опыту, многие коллекционеры и дилеры используют термин «как новый» для описания этого состояния).

ОТЛИЧНОЕ: Новое состояние, использовался, но мало, без заметных повреждений дерева или металла, идеальное воронение (кроме дульного среза и острых краев).

ОЧЕНЬ ХОРОШЕЕ: В отличном рабочем состоянии, на рабочих поверхностях нет заметного износа, коррозии или точечной коррозии, только незначительные вмятины или царапины на поверхности.

ХОРОШЕЕ: В безопасном рабочем состоянии, незначительный износ рабочих поверхностей, отсутствие сломанных деталей, отсутствие коррозии или точечной коррозии, которые мешают нормальному функционированию.

УДОВЛЕТВОРИТЕЛЬНОЕ: В безопасном рабочем состоянии, но сильно изношенные, возможно, требующие замены мелких деталей или регулировки, которые должны быть указаны в рекламе, без ржавчины, но могут иметь коррозионные язвы, которые не делают изделие небезопасным или неработоспособным.

NRA СТАРИННОЕ ОГНЕСТРЕЛЬНОЕ ОРУЖИЕ СТАНДАРТЫ СОСТОЯНИЯ:

ЗАВОДСКАЯ НОВИНКА: Все оригинальные детали; 100% оригинальная отделка; в идеальном состоянии во всех отношениях, внутри и снаружи.

EXCELLENT: Все оригинальные детали; более 80% оригинальной отделки; четкие буквы, цифры и рисунки на металле и дереве; неиспорченная древесина; мелкая скважина.

FINE: все оригинальные детали; более 30% оригинальной отделки; четкие буквы, цифры и рисунки на металле и дереве; незначительные следы на древесине; хороший родник.

ОЧЕНЬ ХОРОШО: Все оригинальные детали; нет до 30% оригинальной отделки; оригинальные металлические поверхности гладкие с острыми краями; четкие буквы, цифры и рисунок на металле; древесина слегка поцарапана или
ушибленный; ствол игнорировался для коллекционеров огнестрельного оружия.

ХОРОШО: Некоторые мелкие запасные части; металл гладко ржавый или местами слегка выщербленный, зачищенный или повторно вороненый; основные буквы, цифры и рисунок на металле разборчивы; древесина отполирована, поцарапаны, ушиблены или отремонтированы мелкие трещины; в хорошем рабочем состоянии.

FAIR: заменены некоторые основные детали; могут потребоваться мелкие запасные части; металл ржавый, может быть слегка изъеденным по всему периметру, энергично зачищен или повторно вороненый; закругленные края металла и дерева; основные буквы, цифры и рисунок на металле частично стерты; древесина поцарапана, ушиблена, треснула или отремонтирована в месте поломки; в удовлетворительном рабочем состоянии или могут быть легко отремонтированы и приведены в рабочее состояние.

ПЛОХОЕ: заменены основные и второстепенные детали; требуются основные запасные части и обширная реставрация; металл глубоко изъеденный; основные буквы, цифры и рисунок стерты, древесина сильно поцарапана, помята, треснута или сломана; механически нерабочий; вообще нежелательно как коллекционное огнестрельное оружие.

Байкал МП-43 (ИЖ-43Е-1С) — Waffenlager.net

  • Тидот
  • Пуркаминен
  • Кокоаминен
  • Осат
  • Тесты


Юлейста

Baikal IZH-43E-1C -rinnakkaispiippuista haulikkoa on valmistettu Venäjällä Iževskissä (англ. Ижевск) vuodesta 1986 alkaen, aina nykypäivään asti. Aseesta tuntuu olevan markkinoilla useita hieman toisistaan ​​poikkeavia mallimerkintöjä, kuten MP-43E-1C, IJ-43E-1C и IZH-43E-1C.Улкойшешти ase muistuttaa paljon vanhaa Baikal IJ-58 -haulikkoa, mutta kyse on kuitenkin eri malleista. Suurimmat erot mallien välillä ovat lähinnä laukaisukoneistossa ja lukkorungossa.

Baikal IZH-43 -haulikkoa on valmistettu pääasiassa kaliiperissa 12/76, mutta sitä on saatavilla myös kaliipereissa 12/70, 16/70, 20/70, 20/76, 28/70, 32/70 и .410/76. Байкал ИЖ-43 -хауликот ovat useissa maissa metsästäjien keskuudessa suhteellisen suosittuja, lähinnä edullisen hinnan, varmatoimisuuden ja kohtuullisen laadun ansiosta.

Байкал ИЖ-43Э-1С (МП-43Э-1С)

ИЖ-43 или МП-43

Baikal muutti haulikoiden mallimerkintä tapaa ilmeisesti vuonna 2008, jolloin tyyppimerkinnästä IZH-43E-1C siirryttiin merkintään MP-43E-1C. Sama muutos koski myös muita Baikal haulikoita, kuten MP-27 и MP-18. Osa markkinoilla ilmenevistä poikkeavuuksista merkinnöissä IJ ja IZH, johtuvat ilmeisesti lähinnä venäjänkielen kyrillisten aakkosten (Иж = IZH) транслиттероинниста.On myös mahdollista, että IJ-merkintä на seurausta vanhoista Baikal IJ-18 и IJ-58 mallisista haulikko nimityksistä. Йока тапауксесса уудесса nimityksessä MP-43, kirjaimet MP tulevat erään lähteen mukaan englannin kielen sanoista Mechanical Plant. Tämä olisi sinänsä hieman erikoista, että kirjaimet tulisivat englanninkielen sanoista.

Ракенне

Baikal IZH-43E-1C -rinnakkaispiippuinen haulikko koostuu pääosiltaan piippuparista, etutukista, Anson & Deeley tyyppisestä lukkorungosta ja tukista.Aseen sisäpinnalta kovakromattu piippupari on juotettu toisiinsa kiinni koko matkalta kiinnityskiskon avulla. Мягкий моноблок ja edelleen lukkorungon sisällä olevaan lukkoon. Piippuparin mukana toimitetaan kolme vaihtosupistajaa (Полный, ½ ja IC).

Номер товара:
  • F = Полный, täyssuppea
  • M = модифицированный, ½ над
  • IC = улучшенный цилиндр, parannettu syinteri

Lukkokehyksen sivuilla on yksinkertaiset, eli melko pelkistetyt kaiverrukset.Металлиозиен pintakäsittelynä на sinistys.

Кайверруксет луккорунгон сивулла

Lukko avataan lukkorungon päälle sijoitetun taittovivun avulla. Kääntämällä vipua oikealle ja kääntämällä sulku auki, iskuvasarat virittyvät ja samalla tukin kaulalle sijoitettu varmistin meee automaattisesti päälle.

Taittovipu lukkorungon päällä ja varmistin tukin kaulalla

Aseen tukki ja käsisuojus on valmistettu joko pähkinäpuusta tai vaihtoehtoisesti pyökistä.Кясисуойюс on kiinnitetty piippuparin alapuolelle viputyyppisellä lukitusmekanismilla. Tukki puolestaan ​​on kiinnitetty lukkorunkoon yhdella läpivientipultilla. Pistoolikahvalla varustetussa tukissa ei ole poskipakkaa. Пуосиен tarttumapintoihin on ajettu tavallinen ristikkäiskarhennus, pintakäsittelynä on öljyäminen. Туккин он kiinnitetty kahdella ruuvilla mustasta kumista valmistettu ventiloituperälevy, джосса на логотипе Байкала.

Ulosvetäjä vetää hylsyt ylös patruunapesästä, kun ase taitetaan.Selektiivisilla ejektoreilla varustetuissa malleissa (mallimerkinnässä E-kirjain) ammuttujen patruunoiden hylsyt lentää patruunapesästä ulos automaattisesti, кун асэ тайтаан. Ampumattomat patruunat jäävät tietenkin patruunapesään.

Байкал ИЖ-43Е-1С-маллисса на ыкси лийпайсин (1С = ыкси лийпайсин) и лийпайсимесса пиипун валицин. Кун valitsinnappi on painettu oikealle, laukeaa liipaisimesta vedettäessä oikeanpuoleinen piippu. Пийпун valitsinta tulee käyttää напрасно кун асе на varmistettuna.

Байкал ИЖ-43 маллит

Toisistaan ​​hieman poikkeavia Baikal IZH-43 -malleja on ainakin kolme erilaista. Байкал ИЖ-43Э малисса on selektiivinen ejektori, joka poistaa vain ammutun patruunan hylsyn. ИЖ-43Е-1С -малисса на селектививинен ejektori ja yksi liipaisin, piipun valitsimella varustettuna. ИЖ-43 КН на ковбойском тюлинене (лыгыт 51 см) пииппупари), ulkoisilla hanoilla varustettu rinnakkaispiippuinen haulikko.

Туотанто

Байкал ИЖ-43Е-1С -rinnakkaispiippuisia haulikoita on valmistaa Ижевскин (Иже́вск) asetehdas SUP Ижевский Механический завод Ижевскисса, joka on eräs maailman suurimmista haulikoiden valmistajista.Маллия ИЖ-43 (MP-43) на valmistettu vuodesta 1986 alkaen, aina nykypäivään asti. Туотантомяэра на тунтематон.

Суомесса

Baikal IZH-43E -haulikoita tuo Suomeen maahantuojana toimiva Oy K. Hjorth Ab. Хауликкомаллия на мыйты Suomessa 1980-luvun lopulta, nykypäivään asti. Nykyisin haulikon tyyppimerkintä on Suomessakin yleensä Байкал МП-43. Ууден Байкал МП-43 — хауликон хинта на никысин ноин 500 евро.

Хуом!

Teräs- ja volframihauleja ei tule ampua, kun aseessa on kiinni puolisuppeaa tiukempi supistaja.Малилья, jossa patruunapesä on 12/70 ei tule käyttää patruunoita, joissa on merkintä 1050 Bar tai 1370 Bar. 12/76 kaliiperisella voidaan ampua 1050 Bar sekä merkinnällä 1370 Bar varustettuja patruunoita. Асиэсса эй myöskään tule käyttää täyteisiapatruunoita, joiden luoti on valmistettu teräksestä tai messingistä.

Байкальский механический завод

Техдас перустеттин Ижевский туйсен маайлмансодан айкана 21.7.1942. Техдас перуштеттин jakamalla asetehdas nro 74 kahtia.Uudesta tehtaasta tuli tehdas nro 622, joka keskittyi käsiaseiden valmistukseen.

Venäläiset siirsivät toisen maailmansodan jäälkeen, vuonna 1947 miehitysalueelleen jääneen JP Sauerin und Sohn GmbH, Suhlin kaupungissa toimineen saksalaisen asetehtaan koneet Neuvostoliittoon, Ижевскин каупункиин, техдас nro 662 yhteyteen.

Tehdas aloitti nyt urheilu- ja metsästysaseiden valmistuksen Baikal tuotemerkillä. Энсиммайнен хауликко малли оли ИЗМ-49, вуодельта 1949 г.IZM-54 на oikeastaan ​​täydellinen Sauer kopio, Гринер-тииппизин риститапписулькуинин.

Ilmeisesti lähinnä kaupallisista syistä IZM-merkistä luovuttiin ja tilalle otettiin länsimaisittain киржойетту Байкал. Baikal haulikoita alettiin viedä ulkomaille 1960-luvulla, myös Suomeen.

Ижевский механический завод на валмистануте Байкал-туотемеркилля nimettyjä urheilu- ja metsästysaseita yli 60 vuoden ajan, joita on myyty maailman laajuisesti yli 70 eri maahan.


Ляхделуэтелло

  • Arma Fennica – Vanhat aseet 1 (1880–1950), Тимо Хюитинен, 2003
  • Arma Fennica — Vanhat aseet 2 (1950–1970), Тимо Хюитинен
  • Arma Fennica – Vanhat aseet 3 (1970–1990), Тимо Хийтинен, 2006
  • Байкал, Ижевский механический завод, url: http://www.imzcorp.com, 20.01.2016
  • Байкал МП-43, url: http://www.imzcorp.com, 10.09.2018
  • Обзор ружья Байкал МР-43Э-1С, url: http://www.Shootinguk.co.uk, 10.09.2018
  • Байкал ИЖ-43 МКПП, 2004 г.

★ 6.10.2018 (✪ 20.12.2018)

делает чтение на экране проще и быстрее.

Сколько стоит Билайн?

Инструменты BeeLine доступны для нескольких платформ. Вот разбивка затрат:

  • Плагин для браузера (Chrome/Firefox/Brave): 2 доллара в месяц за один браузер или 4 доллара.50/месяц для 5 браузеров. Вы можете подписаться ежегодно, чтобы получить скидку.

  • Плагин PDF (Chrome/Brave): 5 долларов США в месяц для всех браузеров, связанных с вашей учетной записью Google

  • Приложение для iOS : Наше отмеченное наградами приложение для iOS позволяет сохранять новостные статьи и другой веб-контент в личный список для чтения, где вы можете прочитать его с помощью нашей запатентованной технологии (4,99 долл. США). Если вы хотите просматривать веб-сайты с помощью приложения BeeLine, приобретите одно из дополнений к новостям (1-5 долларов США, единовременная плата).Чтобы читать все свои книги Kindle с помощью BeeLine, добавьте функцию электронных книг (бесплатная 3-дневная пробная версия; единовременная плата в размере 20 долларов США). Покупки синхронизируются на всех ваших устройствах iOS. Функция Kindle доступна только на iPad (из-за ограничений Amazon, извините!).

Вы также можете бесплатно использовать BeeLine на платформе Bookshare, платформе Reading Is Fundamental Literacy Central и других поддерживаемых веб-сайтах. Если у вас есть любимый веб-сайт, который вы хотели бы видеть с функциями BeeLine, отправьте им запрос на добавление функций со своим предложением!


У меня есть подписка на плагин для браузера.Как добавить/подставить новый браузер?

Просто используйте форму на этой странице, чтобы получить код своей учетной записи, который вы можете использовать для регистрации вашего нового браузера.


У меня тарифный план Worker Bee (1 браузер), но я хочу перейти на план Honey Bee (5 браузеров). Как я могу это сделать?

Мы позаботимся об этом за вас — просто напишите нам по электронной почте, а мы позаботимся обо всем остальном!


Есть ли у вас скидки на обучение?

Мы предлагаем скидки на обучение, которые начинаются примерно с 3 долларов США на учащегося в год для одного класса и еще дешевле для школьных и окружных лицензий.Вы можете увидеть все детали здесь, или напишите нам, если у вас есть другие вопросы.


Поддерживается ли БиЛайн образовательными исследованиями?

BeeLine поддерживается исследовательскими исследованиями в области образования, которые проводились с учащимися от первого класса до старшей школы. Все исследования BeeLine были разработаны и проведены независимыми преподавателями, и мы не платили ни за одно из исследований. Вы можете прочитать краткое изложение исследования BeeLine здесь или написать нам, если вас интересуют полные отчеты об исследовании.


Можно ли бета-тестировать новые инструменты БиЛайн до их выхода?

Да — здесь вы можете зарегистрироваться в качестве бета-тестера и указать, какие платформы вам интересны.


У меня есть сайт, на котором я хочу подключить БиЛайн. Это возможно?

Конечно! У нас есть виджет javascript, который можно добавить на любой сайт.Просто напишите нам по электронной почте, чтобы узнать, как это сделать!


У меня другой вопрос!

Напишите нам по электронной почте, и мы свяжемся с вами в ближайшее время.


оминаисудет, суоситтелут. Izhevskin mekaanisen laitoksen metsästyskivääri

Izhevskin mekaaninen tehdas on tuottanut ja tuottaa edelleen korkealaatuisia aseita, joihin metsästäjien koko sukupolvia tuodaan esille.ИЖ-43-асе он каксоиспутки ваакасуора вийва, йоста он туллут сеураава вайхе техтаан тойминтаа массатуотантун таркоитеттуйен асейден туотанносса. Mallia luotiin IZH-58-aseen pohjalta, joka puolestaan ​​irrotti kokoonpanolinjan edullisemmaksi versioksi luotettavasta, mutta kalliisesta Izh-54-kaksinkertaisesta aseesta . Tänään keskustelemme IZH-43-aseen ulkonäön historiasta, ominaisuuksista, suosituksista ja paljon muuta.

tuotanto

Izhevskin mekaanisen laitoksen suunnittelijoiden työ IZH-43-aseen kehittämiseksi alkoi vuonna 1984.Kirjaimellisesti kaksi vuotta myöhemmin malli on jo tullut massatuotantoon. Armeija onnistui tekemään halvempaa, mutta teknisesti täydellisempiä mallia. Parannukset ovat koskeneet pääasiassa turvallisuus- ja ejektorimekanismeja. Kysymys ratkaistiin myös kengän asentamisella varretukeen.

Tehtävä halvan yleisen kaksoisputkirakenteen luomiseen saatiin sataprosenttisesti. Vuonna 1995 tuotettujen IZH-43-aseiden määrä oli 300 000. Pistoolien vapauttaminen eri versioissa, jokaisesta mausta ja taskusta, toteutetaan tänään.Vain nyt mallia kutsutaan MR-43: ksi. Malli hankkii paitsi kotimaiset metsästäjät, myös hyvien aseiden ulkomaalaiset.

Suunnitteluominaisuudet

IZH-43-aseen päähaara on sen ominaispiirre. Kokeneiden metsästäjien suosittelut osoittavat, että malli on erinomainenhinta- ja laatutason yhdistelmä. Puhutaan nyt kaikesta järjestyksessa.

IZH-43-ase on kaksisäiliöinen sileäpora-ase, jonka tynnyriyksikkö on vaakasuora järjestely. Runkopalkissa rungot kiinnitetään yhteen muff-liitännän avulla.Rungon pituuden takia niiden liitos on alemman ja näköhihnan ansiosta. Ase on kiväärin sisäpuolella. Kappaleet on valmistettu monoblockina, jossa on nastat ja valot.

Aseen parannusprosessissa vasarat valmistettiin erottaen iskuilta. Joissakin muutoksissa aseen asennetaan ulkoisia laitteita virittämiseen ja joustaviin jousiin. Nämä laitteet suoritetaan väärien sankojen muodossa. Muissa versioissa, joissa on kaksi laukaisinta, on mahdollista sulkea vasarat tasaisesti vyöhykkeeltä sulakkeen ansiosta.Lisäksi on olemassa malleja, joihin on asennettu vain yksi laukaisu.

Turvamekanismilla на автоматическом aktivointi nostettaessa. Hän estää liipaisimen ja kuiskaisee. Vaakasuora IZH-43 on kierretty lieriömäisiä taistelulähteitä. Pistooli voi olla joko selektiivisten ejektoreiden kanssa tai ilman. Tämän mallin runkoilla on jatkuva kuonon supistuminen ja vaihdettavat kuristimet. «Магнум» — версия kotelon pituus 76 mm voi olla sylinterimäinen porakone. Lukitustangon lukitsemiseksi sinun on työntävä lukitusstangon kahvaan.

Kalininin laukaisu- ja laukaisumekanismi

Mallin ensimmäisissä kappaleissa oli indexi «43» tai «43E». Он асенсиват эритыисен УСМ: н, йонка суунниттелия А. Н. Калинин суунниттели. Näiden aseiden suurin etu oli, että heillä oli kaksi laukaisinta, joista kukin voikin ampua kahdesta tynnyristä. Kun paintat etupainiketta, oikea piippu ampui ja sitten vasen. Taaksepäin laskeutuneita rungot ammuttiin päinvastaisessa järjestyksessä. Halutessasi voit voittaa tavallisella tavalla — painamalla rinteitä alaspäin vuorotellen.

Pian kasvi lopetti kaksinkertaisen tynnyrin tuottamisen tällaisella iskunvaimennusmekanismilla. Merkinnässä IZH-43M ja IZH-43EM alkoivat tuottaa aseita USM: llä vakiotoimintaan. Kasvi säilytti kykynsä täydentää aseensa USM Kalininiin. Tällaiset jäljennökset tehtiin palasina, järjestyksessä. Hieman myöhemmin aseet saivat vanhoja merkkejä. Ja 90-luvulta lähtien kasvi on käynnistänyt kiväären tuotannon yhdella laukaisulla ja mahdollisuuden vaihtaa laukausten järjestystä.

Vahvuudet ja heikkoudet

Pistoolin edut liittyvät pääasiassa hinnan ja laadun yhdistelmään.Koska suhteellisen edullinen, IZH-43-kaksoisputki on erittäin hyvä taistelu, se antaa tarkkaa tarkkuutta ja terävyyttä, kun se toimii ammuttuina, se näyttää hyviä tuloksia luodinkestävyydella ja silläitätlineus ja luotettavtavuus Малли на hyvä tasapaino. USM: n muotoilu sulkee pois mahdollisuuden vahingossa tapahtuvaan ammuntaan. Ilman liipaisinta painamatta kuvaa ei ole mahdollista.

Mita puutteista he ovat, niin kuin edullinen massatuotanto, ilmenee eri tavoin riippuen puolueesta ja mallista.Kokeneet metsästäjät, jotka haluavat ostaa aseen IZH-43, valitsevat huolella useita malleja parhaiten. Voittajat ovat myös omistajia, jotka eivät ole laiskoja työskennellätieostoon, koska suurin osa puutteista voidaan eliminoida yksin, kotona. Алла на esimerkkejä tällaisesta virityksestä.

Kodin viritys

Usein Izh-43 kaksois tynnyrit kärsivät puutteiden huonoisesta kyllästyksestä ja käsittelystä. Ratkaise ongelma auttaa itse kyllästämiseen ja kiillotukseen (ja joissakin tapauksissa jopa sopivaan) näihin osiin.Seuraava ongelma on ejektorin vika. Тарвицет напрасно тиедостон.

Joskus poltettaessa laskujen turvakaarta, sen epäonnistuneen muodon vuoksi, vahingoittaa sormea. Voit ratkaista tämän ongelman joko uudestaan ​​tai peittää se suojakerroksella. Korroosionestopinnoite Izhevskin mekaanisen laitoksen ampuma-aseissa jättää usein paljon toivomisen varaa. Siksi monet käyttäjät estävät ruostumisen pitkäaikaisessa metsästyksessä myös voitele aseen öljyllä.

versiot

Tähän mennessä ase on tuotettu MP-43: n nimissä tällaisissa kaliereissa:

  1. 12.(70 тай 76 мм).
  2. 16. (70 мм).
  3. 20. (76 мм).
  4. 410-й (76 мм).

Kammion pituus on merkitty suluissa.

410-armeijan versio valmistetaan porakoneiden porauksessa kahdessa versiossa: sylinteri, jossa on pää ja terä tai sylinteri, jossa on pää ja rikastin. Маллин ИЖ-43 (12 миттарин) rungon pituus на 750 мм. Pienemmässä kaliipissa, pituus на 510 — 710 мм. Nyt harkitse eriksen kaikki muut aseiden muutokset.

Ил-43Э

Тямя на перусмалли, йолла на валикоива тыппи эжектори, йока войдаан кыткеа поис пяялта.Kun ejektori on päällä, avaamalla tynnyrit avautuu vain käytetty patruunan kuori, koko patruuna pysyy paikoillaan. Tämä on erittäin kätevä tapauksissa, joissa sinun on ladattava nopeasti ase.

IL-43-1S

Malli on erilainen siinä, että silla on vain yksi laukaisu. Yläosassa on kytkin, jonka avulla voit helposti vaihtaa laukausten järjestyksen runkoista. IZH-43E-1C-versio eroaa edellisestä, koska se, kuten IZH-43E, on varustettu ejektorimekanismilla.

IL-43K

Tämä 12-ulottumainen kaksirumpu sopii niille, jotka haluavat kuljettaa aseita varaustilassa ja nopeasti kukkivat jouset avaamatta pistoolia.Mallin kohokohta на murshurssien läsnäolo. Malmin Izhevskin työntekijöiden yllätykseksi malli herätti kiinnostusta historiallisten aseiden americkalaisten fanien keskuudessa. On jopa tietoa, että erityisesti markkinoille suunnitellut mallit on valmistettu falshin ja putkien kanssa.

Ил-43КН

Täysipäiväinen ulkomailta tupakoiva malli. Саатавана напрасно 12. калиперин. Kun nostetaan, satunnaiskuvan mahdollisuus vähenee nollaan. Mikään ei tapahdu, vaikka koskettaisit liipaisinta.

ИЖ-43: n versioita voidaan kutsua joko yllä kuvatulla tavalla tai merkinnällä «MR» IZH: n sijasta. Listautettujen tavallisten mallien lisäksi Izhevskin tehdas tuottaa myös kappaletta, jonka erinomaiset taistelut ja hieno viimeistely jalometallien avulla erottavat. Nämä ovat IZH-43-aseen ominaisuuksia.

Arviot

Käyttäjät enemmistöllä ovat erittäin positiivisia tämän mallin aseista. Joku voi kysyä: «Нет, mitä haitoista?» Tosiasia on, ettähintaluokassa, jossa tämä tuote sijaitsee, se toimii hyvin.Siksi, puutteista puutteista, kannattaa miettiä, kuinka paljon aseet ovat kustannuksia, jotka ovat riittämättömiä näistä ongelmista. No, kun suurin osa ongelmista ratkaistaan ​​kotona (ja slaavilaiset miehet eivät suvaitse laitteiden korjaamista ja edes pitävät siitä kovin paljon), ase onnistui todella voittamaan metsästäjien sydämet.

Asennuksen purkaminen arvioiden mukaan on erittäin helppoa ja nopeaa. Ase on vaatimaton toimintakunnossa ja silla on riittävän tarkka ammunta alkuvarustajille.Mutta kokeneet ampujatvastaavat tarpeeksi hyvin hänelle. Koska IZH-43-ase toimii itsestään lataamattomilla patruunoilla ilman ongelmia, se on todellinen lahja niille, jotka haluavat varustaa ammuksia. Kasetteja ei tarvitse kalibroida liian huolellisesti. Höyryissä aseet eivät toimi huonommin kuin kesällä. Erityisiä valituksia omistajienvastauksissa ei havaittu.

johtopäätös

Tänään olemme oppineet, mitä kaksoispalkin horisontti IZH-43 edustaa. Ominaisuudet, omistajan arvostelut ja valokuvat antoivat meille mahdollisuuden saada täydellisin kuva tuotteesta.Ase todella ansaitsee huomiota, erityisesti ensimmäiset versiot ja mallit, jotka tuotettiin kappaleittain. Heille metsästäjille kohdellaan erityisen huolestuneisuutta ja kunnioitusta. Yli yhden sukupolven Neuvostoliiton ja sitten venäläiset venäläiset pojat kasvoivat Izhevskin tehtaan kivääriin. Todennäköisesti IZ-mallit eivät ainoastaan ​​muistuta itseämme ja ulkomaisilta markkinoiltamme laadukkaita, mutta edullisia aseita.

оминаисудет, суоситтелут. Izhevskin mekaanisen laitoksen metsästyskivääri

Izhevskin mekaaninen tehdas tuotti ja jatkuutuottaa korkealaatuisia aseita, joihin metsästäjien koko sukupolvesta syntyy.ИЖ-43-асе он каксоиспутки ваакасуора вийва, йоста он туллут сеураава вайхе техтаан тойминтаа массатуотантун таркоитеттуйен асейден туотанносса. Mallia luotiin IZH-58-aseen pohjalta, joka puolestaan ​​irrotti kokoonpanolinjan halvemmaksi versioksi luotettavasta mutta kalliisesta Izh-54-kaksinkertaisesta aseesta. Tänään keskustelemme IZH-43-aseen ulkonäön historiasta, ominaisuuksista, suosituksista ja paljon muuta.

tuotanto

Teos Izhevskin mekaanisten suunnittelijoiden työstäIZH-43-aseen kehittämistyö alkoi vuonna 1984.Kirjaimellisesti kaksi vuotta myöhemmin malli on jo tullut massatuotantoon. Armeija onnistui tekemään halvempaa mutta teknisesti täydellisempiä mallia. Parannukset ovat koskeneet pääasiassa turvallisuus- ja ejektorimekanismeja. Kysymys ratkaistiin myös panoksen asentamisella piipun lohkoon.

Tehtävä halvan universaalin luomiseenkaksoisputkihaulikko suoritettiin sataprosenttisesti. Vuonna 1995 tuotettujen IZH-43-aseiden määrä oli 300 000. Pistoolien vapauttaminen eri versioissa, joka makuista ja taskuista tehdään tänään.Vain nyt mallia kutsutaan MR-43: ksi. Mallia hankkivat paitsi kotimaiset metsästäjät, myös hyvien aseiden ulkomaalaiset.

Suunnittelun ominaisuudet

IZH-43-aseen päähippu on sen ominaisuuksia. Kokeneiden metsästäjien suosittelut osoittavat, että malli on erinomainenhinta- ja laatuyhteistyö. Puhutaan nyt kaikesta järjestyksessa.

IZH-43-ase on kaksoisputkisileät reiät, joiden tynnyriyksikkö on vaakasuora järjestely. Runkopäässä rungot kiinnitetään toisiinsa muffikytkennällä.Rungon pituuden takia niiden liitos on alemman ja kohdistuspalkin ansiosta. Ase on kiväärin sisäpuolella. Kappaleet on valmistettu monoblockina, jossa on nastat ja valot.

Parannettaessa ampuma-aseita, terästätehdään eriksen ampujien jookosta. Joissakin muutoksissa aseen on asennettu ulkoiset laitteet jousituksen ja jousen tasaiselle alenemiselle. Nämä laitteet suoritetaan väärien lokeroiden muodossa. Muissa versioissa, joissa on kaksi liipaisinta, mahdollisuuden sujuvasti irrottaa vasarat kentästä on mahdollista sulakkeen ansiosta.Lisäksi on olemassa malleja, joihin on asennettu vain yksi laukaisu.

Turvamekanismilla on automaattinensisällyttäminen, kun nostetaan. Hän sulkee liipaisimen ja kuiskaisee. Vaakasuorat tasot IZH-43 ovat kiertyneet lieriömäiset taistelulangat. Pistooli voi olla joko selektiivisten ejektorien kanssa tai ilman niitä. Tämän mallin rungoissa on jatkuva kuonon supistuminen ja vaihdettavat kuristimet. «Магнум» — версия котела 76 мм: n putkikammioon voivat olla sylinterimäinen porakone. Lukitustangon lukitsemiseksi sinun täytyy työntää lukituspalkki kahdelle kiinnittimelle.

Калинин iskunvaimennusmekanismi

Mallin ensimmäiset kopiot olivat «43» — tai»43E». Он асенсиват эритыисен УСМ: н, йонка суунниттелия А.Н. Калинин суунниттели. Näiden aseiden suurin etu oli, että heillä oli kaksi laukaisinta, joista kukin voisi ampua kahdesta tynnyristä. Kun paintat etupainiketta, oikea tynnyri käynnistetään ja sitten vasen. Taakse laskeutuneilta rungot ammuttiin päinvastaisessa järjestyksessä. Halutessasi voit voittaa tavallisella tavalla — painamalla rinteitä alaspäin vuorotellen.

Pian kasvi lopetti tupakansytyttimien tuottamisenkivääri, jolla on tällainen iskunvaimennusmekanismi. Merkkivalossa IZH-43M ja IZH-43EM alkoivat tuottaa ampuma-aseita USM: llä vakiotoimintaan. Kasvi säilytti kykynsä täydentää aseensa USM Kalininiin. Sellaiset kopiot tehtiin palasina, tilauksen mukaan. Hieman myöhemmin aseet saivat vanhoja merkkejä. Ja 90-luvulta lähtien kasvi on käynnistänyt kiväären tuotannon yhdella laukaisulla ja mahdollisuuden vaihtaa laukausten järjestystä.

Vahvuudet ja heikkoudet

Pistoolin edut liittyvät pääasiassayhdistelmähinta ja laatu.Suhteellisen alhainen, kaksipiippuinen haulikko IL-43 on erittäin hyvä taistelu antaa kunnollinen tarkkuutta ja terävyyttä työskenneltäessä osa, osoittaa hyviä tuloksia kuvattaessa, ja on luotäsitetava ja ennakoitavissa oleva turvalllänen Маллисса на hyvä tasapaino. Usman eliminoi mahdollisuuden vahingossavastuuvapauden. Painamatta liipaisinta laukaus на махдотонте.

Mita puutteista he ovat, niin kuin sopiiedullinen massatuotanto, joka ilmenee eri tavoin riippuen puolueesta ja mallista.Kokeneet metsästäjät, jotka haluavat ostaa aseen IZH-43, valitsevat huolella useiden malleja parhaiten. Voittajat ovat myös omistajia, jotka eivät ole laiskoja työskennellätieostoon, koska suurin osa puutteista voidaan poistaa itsestään, kotona. Seuraavassa on muutamia esimerkkejä tällaisesta virityksestä.

Kodin viritys

Usein haulikko IL-43 kärsi huono kyllästysja puuosien käsittely. Ratkaise ongelma auttaa itse kyllästämiseen ja kiillotukseen (ja joissakin tapauksissa jopa sopivissa) näistä osista.Seuraava ongelma on ejektorin vika. Täällä se tarvitsee напрасно тиедстон.

Joskus turvalaitteen poltettaessarinteillä epäonnistuneen muodon vuoksi vahingoittaa sormea. Jotta voit päästä eroon tästä ongelmasta, sinun on joko remontoitava tai peitettävä se suojakerroksella. Korroosionkestävä pinnoitus Izhevskin mekaanisen laitoksen aseissa jättää usein paljon toivomisen varaa. Siksi monet käyttäjät estävät ruostumisen esiintymisen pitkäaikaisessa metsästyksessä voitele kivää öljyllä.

versiot

Tähän Mennessä ase on tuotettu MP-43: n nimissä tällaisissa kaliereissa:

  1. 12.(70 тай 76 мм).
  2. 16. (70 мм).
  3. 20. (76 мм).
  4. 410-й (76 мм).

Kammion pituus on merkitty sulkeissa.

410-kivääri-versio on valmistettutynnyreiden poraus kahdessa versiossa: sylinteri, jossa pää ja terä tai sylinteri, jossa pää ja rikastin. Маллин ИЖ-43 (12 миттарин) rungon pituus на 750 мм. Pienemmässä kaliipissa, pituus на 510 — 710 мм. Nyt harkitse eriksen kaikki muut aseiden muutokset.

Ил-43Э

Тямя на перусмалли, йока на вайхдеттависсаваликоива эжектори.Kun ejektori on päällä, avaamalla tynnyrit vain käytetty patruunan kuori pääsee ulos, koko patruuna pysyy paikoillaan. Tämä on erittäin kätevä tapauksissa, joissa sinun on ladattava nopeasti ase.

Ил-43-1С

Malli eroaa siitä, että silla on vain yksilaukaista. Yläosassa on kytkin, jonka avulla voit helposti vaihtaa laukausten järjestystä rungoista. IZH-43E-1C-versio eroaa edellisestä, koska se, kuten IZH-43E, on varustettu ejektorimekanismilla.

IL-43K

Tämä 12-ulottumainen kaksoisputki soveltuu niille, jotka haluavatkuljettaa aseet varaustilanteessa ja nopeasti kukkivat jouset avaamatta pisttoolia.Mallin kohokohta на murshurssien läsnäolo. Maanrakennuslaitoksen työntekijöiden yllätykseksi malli herätti kiinnostusta historiallisten aseiden americkalaisten fanien keskuudessa. On jopa tietoa, että mallit, jotka on erityisesti suunniteltu tälle markkinalle falshandtrubkamiin.

Ил-43КН

Täysipäiväinen ulkomailta tupakoiva malli. Se on tuotettu напрасно 12. kaliiperi. Kun nostetaan, satunnaiskuvan mahdollisuus vähenee nollaan. Mikään ei tapahdu, vaikka koskettaisit puhujan liipaisinta.

ИЖ-43: n versioita voidaan kutsua joko nimellaedella tai etiketti «MR» sijasta «IZH». Listautettujen tavallisten mallien lisäksi Izhevskin tehdas tuottaa myös kappaletta, jonka erinomaiset taistelut ja hieno viimeistely jalometallien avulla erottavat. Nämä ovat IZH-43-aseen ominaisuuksia.

Arviot

Käyttäjät enemmistöllä ovat hyvinsuhtautuvat positiivisesti tämän mallin aseista. Joku voi kysyä: «Mutta entä puutteet?» Tosiasia on, ettähintaluokassa, jossa tämä tuote sijaitsee, se toimii hyvin.Siksi, puutteista puutteista, kannattaa miettiä, kuinka paljon aseet maxaisivat, jotka ovat riittämättömiä näistä ongelmista. No, kun suurin osa ongelmista ratkaistaan ​​kotona (ja slaavilaiset miehet eivät suvaitse laitteiden korjaamista ja edes pitävät siitä kovin paljon), ase todella onnistui voittamaan metsästäjien sydämet.

Kipinöiden purkaminen tapahtuu tarkastelujen mukaanerittäin helppo ja nopea. Asema on vaatimaton toimintakunnossa ja silla on riittävän tarkka ampuma-alus metsästäjille.Mutta kokeneet ampujatvastaavat tarpeeksi hyvin hänelle. Koska IZH-43-ase toimii itsestään lataamattomilla patruunoilla ilman ongelmia, se on todellinen lahja niille, jotka haluavat varustaa ammuksia. Kasetteja ei tarvitse kalibroida liian huolellisesti. Höyryissä aseet eivät toimi huonommin kuin kesällä. Erityisiä valituksia omistajienvastauksissa ei ole huomattu.

johtopäätös

Tänään opimme, mikä onKaksoiskaravaiset vaakatasot IZH-43. Ominaisuudet, arvosteluja ja kuvia omistajien antoi meille mahdollisuuden saada täydellisin kuvan.Haulikko todella huomiota, etenkin ensimmäiset versiot ja malleja, jotka on tuotettu kappaleittain. Nämä metsästäjät hoidetaan erityistä kunnioitusta ja kunnioitusta. Käytössä aseet Izhevsk kasvi on kasvanut enemmän kuin yksi sukupolvi Neuvostoliiton ja Venäjän silloisen pojat. Ja todennäköisesti, IL malli yhä uudelleen muistuttaa itseäni meidän ja ulkomaisilla markkinoilla laadukas mutta edullinen aseet.

Деградация 2,3-дигидроксибензоата новым путем мета-расщепления

Abstract

2,3-дигидроксибензоат является предшественником в биосинтезе нескольких сидерофоров и важным вторичным метаболитом растений, который в бактериях может разлагаться посредством мета — расщепление ароматического кольца.Кластер dhb Pseudomonas reinekei MT1 кодирует химерный путь расщепления meta , участвующий в катаболизме 2,3-дигидроксибензоата. В то время как первые два фермента, DhbA и DhbB, филогенетически родственны ферментам, участвующим в деградации 2,3-дигидрокси- p -кумата, последующие стадии катализируются ферментами, родственными ферментам, участвующим в деградации катехолов (DhbCDEFGH). Характеристика кинетических свойств экстрадиолдиоксигеназы DhbA выявила 2,3-дигидроксибензоат в качестве предпочтительного субстрата.Делеция кодирующего гена препятствует росту P. reinekei MT1 на 2,3-дигидроксибензоате. DhbA катализирует 3,4-диоксигенирование с 2-гидрокси-3-карбоксимуконатом в качестве продукта, который затем декарбоксилируется с помощью DhbB до 2-гидроксимуконового полуальдегида. Затем это соединение подвергают дегидрированию и дальнейшему разложению до промежуточных продуктов цитратного цикла. Анализ транскрипции показал, что гены кластера генов dhB сильно экспрессируются во время роста с 2,3-дигидроксибензоатом, тогда как локализованный ниже по течению ген, кодирующий 2-гидроксимуконовую полуальдегидгидролазу, необязателен для метаболизма 2,3-дигидроксибензоата, но имеет решающее значение для 2,3-дигидроксибензоата. Разложение 3-дигидрокси- p -кумата было лишь незначительно выражено.Это первое сообщение, описывающее кластер генов, кодирующий ферменты для деградации 2,3-дигидроксибензоата.

ВВЕДЕНИЕ

Бактерии синтезируют небольшие железохелатирующие молекулы, называемые сидерофорами, для облегчения усвоения железа. Поскольку доступность этого элемента во многих средах ограничена, сидерофоры имеют решающее значение для приспособленности и вирулентности бактерий (12). Одним из наиболее изученных сидерофоров является энтеробактин, продуцируемый энтеробактериями, такими как Salmonella enterica и Escherichia coli (43).Центральным промежуточным продуктом в синтезе этого сидерофора является 2,3-дигидроксибензоат (2,3-ДГБ), который также является предшественником в синтезе ангибактина и вибриобактина (12). Более того, 2,3-ДГБ признан важным вторичным метаболитом растений (5). Однако, несмотря на его сходство с центральными промежуточными продуктами бактериального пути деградации ароматических соединений, такими как 3,4-дигидроксибензоат (протокатехуат), имеется лишь ограниченная информация о деградации 2,3-DHB.

Ранее было показано, что P.fluorescens 23D-1 может разлагать это соединение (44), и этот метаболизм инициируется экстрадиолдиоксигеназой, вероятно, расщепляющей субстрат между атомами углерода C-3 и C-4 (45). Расщепление 2,3-DHB экстрадиолом ( мета -) также наблюдалось в штамме Pseudomonas putida (3). Однако еще не выяснено, было ли наблюдаемое последующее декарбоксилирование продукта расщепления кольца с образованием 2-гидроксимуконового полуальдегида спонтанным или катализируемым ферментом.Альтернативные пути были описаны у грибов, таких как Trichosporum cutaneum , где деградация 2,3-DHB инициируется декарбоксилазой (2), или у растений, таких как Tecomastans , где деградация происходит посредством расщепления интрадиола (49). . В текущем отчете мы выяснили деградацию 2,3-DHB с помощью Pseudomonas reinekei MT1 и смогли идентифицировать кластер генов, участвующих в этом метаболическом пути.

МАТЕРИАЛЫ И МЕТОДЫ

Бактериальные штаммы, плазмиды и условия роста.

Бактериальные штаммы и плазмиды, использованные в этом исследовании, перечислены в . Штамм MT1 P. reinekei выращивали в минимальной среде, как описано ранее (39), с 2 мМ 2,3-дигидроксибензоата в качестве единственного источника углерода. Среду Луриа-Бертани (LB) использовали в качестве богатой среды для штаммов E. coli и P. reinekei . Для отбора мутантов использовали среду ABC (среда AB [11] с добавлением микроэлементов [17] и 20 мМ цитрата). Для E. coli использовали следующие антибиотики: ампициллин (Ap; 200 мкг/мл), карбенициллин (Cb; 100 мкг/мл), гентамицин (Gm; 10 мкг/мл) и тетрациклин (Tc, 10 мкг/мл). /мл).Для P. reinekei использовали антибиотики Gm (200 мкг/мл) и Tc (15 мкг/мл).

Таблица 1

штаммов и плазмиды, используемые в этой работе

— + +
бактериальный штамм или плазмида Соответствие описания Источник или ссылка
E.coli
JM109 E14 (MCRA ) Reca1 Enda1 Gyra96 Thi-1 HSDR17 (R K M K + ) Supe44 Rela1 Δ ( Lac-Proab ) [F ‘ Trad36 Proab LACI Q Z Δ M15 ] M15 ] STRATAGENE
S17λPIR TPR SMR Reca Thi Pro (R K M K + ) ) RP4 : 2-TC: MUKM TN 7 PIR 15
CC118λpir ( ARA-LEU ) Arad Lacx74 Gale Galk Phoa20 Thi-1 RPSE rpoB argE ( Am ) recA1 pir 27
P.reinekei
МТ1 дикого типа 10
MT1Δ dhbA делеционного мутанта с иссечением на 872 п.н. в гене dhbA Это исследование
Плазмиды
    pEX18Ap Ap r ; ORIT + + SACB + , Вектор замена гена с множественным клонированием сайта из PUC18 29
PPS858 AP R , GM R ; фрагмент PstI-XbaI pPS747 с тупыми концами, лигированный в сайт EcoRI с тупыми концами pPS856; несет кассету Gm r -GFP 29
    pBBFLP Tc r ; источник индуцируемой рекомбиназы FLP 14, 29
    pABdhbA Ap r ; Производное pEX18Ap с ПЦР-амплифицированными областями, фланкирующими ген dhbA (696 п.н. выше и 660 п.н. ниже), клонированное в сайте рестрикции Acc65l/PstI. Это исследование
    pAGBdhbA Ap r , Gm r ; Производное pABmmlC с кассетой Gm r -GFP, клонированной между ПЦР-амплифицированными областями, фланкирующими ген dhbA Это исследование
Клонирование вектор PROMEGA
PC23OHIS218 PC23OHIS218 PC23OHIS218 PC23OHIS218 PC23OHIS218 PGEM-T простая производная, содержащая гену CateChol 2,3-диоксигеназы псевдомонас Veronii 1YDBTEX2 32
PGC23O AP R ; pGEM-T Простое производное с ПЦР-амплифицированной областью размером 995 п.н., содержащей ген dhbA , клонированный в Т-выступах Это исследование

Секвенирование и анализ последовательности.

Кластер генов dhb был локализован путем секвенирования ниже ранее описанного кластера sal P. reinekei MT1, который находится на фосмиде из ранее созданной библиотеки фосмидов (9). Прямое секвенирование проводили с использованием готового набора для секвенирования реакционного цикла ABI Prism BigDye Terminator v1.1 (Applied Biosystems, Фостер-Сити, Калифорния) и генетического анализатора ABI Prism 3100 (Applied Biosystems, Фостер-Сити, Калифорния). Необработанные данные о последовательностях обеих цепей собирали вручную.Поиск сходства ДНК и белков проводили с использованием программ BLASTX и BLASTP с веб-сайта NCBI (1). Транслированные белковые последовательности были сопоставлены с MUSCLE с использованием значений по умолчанию (19). Филогенетические деревья были построены с помощью MEGA5 (53) с использованием алгоритма объединения соседей (47) с коррекцией p-расстояния и попарным удалением пробелов и отсутствующих данных. Всего было выполнено 100 бутстреп-репликаций для проверки устойчивости ветвления.

Конструирование делеционного мутанта

dhbA .

Делеционный мутант гена dhbA , кодирующий 2,3-дигидроксибензоат-3,4-диоксигеназу, был сконструирован с использованием ранее описанной стратегии рекомбинации Flp-Flp recombination target (Flp-FRT) (29). ПЦР-фрагменты амплифицировали с использованием пар праймеров выше (KOC23OAF и KOC23OAR;) и ниже (KOC23OBF и KOC23OBR3;) гена-мишени (∼700 п.н.), несущих сайты рестрикции PstI-BamHI и BamHI-Acc65l, соответственно. Впоследствии они были клонированы в сайт рестрикции PstI-Acc65l вектора pEX18Ap, образуя плазмиду pABdhbA ().Фрагмент BamHI размером 1,8 т.п.н. из плазмиды pS858, несущий кассету Gm r (Gm r -GFP), меченную зеленым флуоресцентным белком, был клонирован в образовавшийся сайт рестрикции BamHI, в результате чего была получена суицидальная плазмида pAGBdhbA (). Эта суицидная плазмида была перенесена в штамм P. reinekei MT1 путем двухродительского скрещивания с использованием штамма E. coli S17λpir в качестве донорного штамма. Трансконъюганты, полученные в результате одиночного кроссинговера, отбирали на среде ABC с добавлением Gm, а меродиплоиды разделяли дополнительным посевом на среду ABC с добавлением 5% сахарозы.Делецию кассеты Gm r -GFP осуществляли путем конъюгации Flp-экспрессирующей плазмиды pBBFLP в полученные штаммы путем двуродительского скрещивания с использованием E. coli CC118λpir в качестве донора и отбора на среде ABC, содержащей Tc. Плазмида pBBFLP была вылечена путем посева штаммов на среду ABC с добавлением 5% сахарозы. Целостность мутанта подтверждали ростом на среде ABC с добавлением различных антибиотиков, ПЦР-амплификацией и секвенированием участков, фланкирующих делетированный ген.

Таблица 2

Праймеры, использованные в данном исследовании

TCACGCCACTCACGAACGG dhbA
Праймер Sequence Размер продукта (п.н.) Задача
KOC23OAF GGAGACTGCAGGCGCACTTGTACATGTT 718 dhbR
KOC23OAR GAGAGGGATCCGCGGCCTCGAACGTTAT
KOC23OBF GGAGAGGATCCGTGACCGCCACGGC 682 dhbB
KOC23OBR3 GAGAGGGTACCGGCAGTGAGGTAATCCC
pGC23OR 995
pGC23OF TCAGATCGGTTTTCATGGG
RT_rpsL_F ATGGCAACTATCAACCAGCTG 280 RPSL
RT_rpsL_R ACCCGGAAGGTCTTTTACAC
RT_mmlL_F CCAGATGCAGTAACCGGAGT 400 mmlL
RT_mmlL_R GGTCATCACCCACCTTCACT
RT_dhbI_F AGGTGTTCGCCTATGACCAG 199 dhbI
RT_dhbI_R CGTCACGACCATGAATCAAC
RT_orf4_F TCTATCGTCAACACGGCATC 205 ORF4
RT_ORF4_R TTGGCAAAGTTGTCTCCTCCT
RT_DHBE_F TTGA GGTCGAAGCGAAAGTT 395 dhbE
RT_dhbE_R GTGGCCGTGACCAAAATAAC
RT_dhbH_F CGGAGTAAGTCGCTCGTTGT 392 dhbH
RT_dhbH_R GCAGATCTATCAGCGTCGTG
RT_dhbA_F CATGATGTCATCGACGGTTT 389 dhbA
RT_dhbA_R CGCAGGTGCTCGAAGATAAT

Клонирование

гена dhbA и экспрессия кодируемого белка.

Участок длиной 995 п.н., несущий ген dhbA , амплифицировали методом ПЦР с использованием праймеров pGC23OR и pGC23OF () и клонировали в векторе pGEM-T Easy (Promega, Германия) с получением плазмиды pGC23O. Плазмиду использовали для трансформации E.coli JM109, и положительные клоны отбирали по устойчивости к ампициллину. Был выбран клон, названный E.coli JM109(pGC23O), и целостность вставки была подтверждена секвенированием. E. coli JM109(pGC23O) выращивали при 37°C в среде LB, содержащей 200 мг ампициллина мл -1 .Для индукции добавляли изопропил-β-d-тиогалактопиранозид (IPTG; 0,5 мМ), когда культуры достигали 0,6. Клетки собирали через 2 ч инкубации при 37°С и ресуспендировали клеточный осадок в 50 мМ фосфатном буфере (рН 8,0).

ПЦР в реальном времени.

P. reinekei MT1 выращивали в течение ночи в минимальной среде с 10 мМ глюконата или 2 мМ 2,3-DHB в качестве источника углерода. Во время экспоненциального роста ( A 600 из 0.8, в случае роста с глюконатом и 70%-ным восстановлением 2,3-DHB, как определено с помощью анализа высокоэффективной жидкостной хроматографии [ВЭЖХ] во время роста на 2,3-DHB), три аликвоты по 2 мл осаждали и добавляли с 1 мл РНКпротекта (Qiagen). Суммарную РНК выделяли с помощью набора RNeasy minikit (Qiagen) в соответствии с инструкциями производителя. Полученную РНК обрабатывали набором Turbo DNase kit (Ambion, Austin, TX) для удаления любого загрязнения ДНК и количественно определяли с использованием Nanodrop 2000c (Peqlab).кДНК синтезировали из 230-580 нг общей РНК с использованием обратной транскриптазы SuperScript III (Invitrogen) в соответствии с процедурой производителя с последующей очисткой кДНК с использованием набора для очистки ПЦР Qiaquick (Qiagen).

Стенограммы

DHBA , DHBE , DHBH , DHBH , DHBI , MMLL , MMLL , и ORF4 были определены количественно с приведенными палями праймеры, а рибосомальный ген RPSL был выбран в качестве ведения домашнего хозяйства. ген (9).Каждую реакцию проводили в двух повторностях в конечном объеме 20 мкл, содержащем 2,5 мкл каждого праймера (10 пмоль), 10 мкл QuantiTect SYBR green PCR Master mix (Qiagen) и 5 ​​мкл матрицы кДНК (соответствует от 1 до 10 нг). . Амплификацию проводили в системе ПЦР в реальном времени LightCycler 480, запрограммированной на выдержку при 95°С в течение 10 мин, а затем на выполнение 50 циклов: 94°С в течение 15 с, 57°С в течение 40 с и 72°С в течение 40 с. с. Результаты ПЦР анализировали с помощью программного обеспечения LightCycler 480 (Roche Applied Science). Стандартные кривые были получены из серийных разведений известных концентраций P.геномная ДНК reinekei MT1 (содержащая от 2 до 2 × 10 6 копий целевого гена мкл -1 ) путем построения графика пороговых циклов (значения C T ) в зависимости от количества копий, предполагая, что 1 нг ДНК содержит 9,8 × 10 90 560 5 90 561 копий всего 90 475 генома P. reinekei 90 476 MT1 (оценивается как 6 Мбн на основе зарегистрированных размеров генома секвенированных штаммов 90 475 Pseudomonas ), где предполагается, что гены-мишени присутствуют в виде одной копии.

Ферментативный анализ.

Экстракты клеток P. reinekei MT1 и E. coli JM109(pGC23O) готовили, как описано ранее (39). Каталитическую активность регистрировали при 25°С в 50 мМ насыщенном воздухом фосфатном буфере (рН 8,0) на спектрофотометре UV 2100 (Shimadzu Corporation). За активностью 2,3-ДГБ-3,4-диоксигеназы следили путем измерения превращения катехола или 3-метилкатехола в 2-гидроксимуконовый полуальдегид (ГМС; ε 375 , 36000 M -1 см -1 ) или 2 -гидрокси-6-оксо-2,4-гептадиеноат (HOPDA; ε 388 , 13800 M -1 см -1 ) соответственно.Коэффициенты экстинкции продуктов расщепления кольца 2,3-ДГБ или 2,3-дигидрокси- п -кумата определяли как ε 343 от 31 600 M −1 см −1 или ε 347 7400 М -1 см -1 соответственно после инкубации от 25 до 50 мкМ субстрата с клеточным экстрактом до полного оборота. Активность протокатехуата и пирогаллола контролировали, регистрируя изменения в УФ-видимом спектре (от 250 до 400 нм) после добавления клеточного экстракта в течение до 30 мин.Каталитическую активность декарбоксилазы 2-гидрокси-3-карбоксимуконового полуальдегида (ГХМС) регистрировали при 375 нм на основании разницы экстинкции субстрата при 375 нм (ε 375 , 16 400 M -1 см -1 ) и продукт HMS. Активность гидролазы HMS измеряли, определяя независимое от NAD + снижение концентрации HOPDA при 388 нм. Дегидрогеназную активность HMS измеряли, определяя NAD + -зависимое снижение концентрации HMS при 375 нм.Добавляли NAD + до конечной концентрации 0,5 мМ. Удельная активность выражена в единицах на грамм белка. V max и K m Значения определяли с использованием от 1 до 100 мкМ (2,3-DHB диоксигеназы) или от 0,2 до 10 мкМ субстрата (2-гидрокси-3-карбоксимуконовой полуальдегиддекарбоксилазы и HMS дегидрогеназы) в буфер, насыщенный воздухом, и кинетические данные рассчитывали по начальным скоростям с использованием уравнения Михаэлиса-Ментен с помощью нелинейной регрессии (KaleidaGraph; Synergy Software).

Аналитические методы.

Трансформацию 2,3-ДГБ контролировали с помощью анализа ВЭЖХ. Аликвоты по 10 мл бесклеточных супернатантов анализировали с помощью системы ВЭЖХ Shimadzu (жидкостный хроматограф LC-10AD, дегазатор DGU-3 A, детектор с диодной матрицей SPD-M10A и смеситель растворителей FCV-10AL), оснащенной колонкой Lichrospher RP8 ( 125 на 4,6 мм; Bischoff, Леонберг, Германия) с использованием системы водных растворителей (скорость потока, 1 мл мин -1 ), содержащей 0,01% (об./об.) H 3 PO 4 (87%, мас./ об. в H 2 O) и 40% (об./об.) метанола, а 2,3-DHB показал удерживаемый объем 3.0 мл.

Для анализа методом ядерного магнитного резонанса (ЯМР) 1 Н продукт расщепления кольца 2,3-ДГБ получали путем количественной трансформации 1 мМ 2,3-ДГБ в 50 мМ фосфатном буфере (рН 8,0) с клеточным экстрактом E. coli JM109 (pGC23O), предварительно индуцированный для индукции DhbA. После полной трансформации субстрата, по данным ВЭЖХ, к 0,56 мл реакционной смеси добавляли 0,14 мл D 2 O. Одномерная и двумерная корреляционная спектроскопия (COSY) 1 Спектры ЯМР Н регистрировали при 300°С. K на ЯМР-спектрометре Avance DMX 600 (Bruker, Райнштеттен, Германия).Центр подавленного сигнала воды (δ = 4,80 м.д.) использовали в качестве внутреннего эталона.

Химикаты.

2,3-дигидрокси- p -кумат был любезным подарком Ричарда Итона (18). 2-Гидрокси-3-карбоксимуконовый полуальдегид и 2-гидрокси-3-карбокси-6-оксо-7-метилокта-2,4-диеноат получали in situ путем инкубации раствора, содержащего 0,1 мМ 2,3-дигидроксибензоата или 2,3-дигидрокси- p-кумат в 50 мМ фосфатном буфере (pH 8,0) с клеточным экстрактом E.coli JM109(pGC23O), предварительно индуцированных для индукции DhbA, тогда как HMS и HOPDA (0,1 мМ) готовили с клеточными экстрактами E. coli JM109(pC23Ohis218), экспрессирующими катехол-2,3-диоксигеназу (32).

РЕЗУЛЬТАТЫ

Идентификация и анализ ORF, участвующих в деградации 2,3-дигидроксибензоата у

P. reinekei MT1.

P. reinekei MT1 способен расти на 2,3-DHB в качестве единственного источника углерода. Анализ 20,2-килобайтной области P.В геноме reinekei MT1 обнаружено присутствие 19 ранее неизвестных открытых рамок считывания (ORF). Эта область обрамлена ранее описанными кластерами генов mmlI и sal и расположена выше ранее идентифицированной ORF, кодирующей предполагаемую гидролазу HMS (9, 38) (и ), теперь называемую dhbI . Можно предположить, что восемь из идентифицированных ORF кодируют белки, гомологичные белкам, участвующим в деградации дигидроксилированных ароматических соединений посредством мета -расщепления.Первая ORF, идентифицированная в этом кластере, названная dhbR , транскрибируется в направлении, противоположном направлению следующих структурных генов, и кодирует предполагаемый регулятор транскрипции типа LysR. Следующий ген, dhbA , кодирует экстрадиолдиоксигеназу, принадлежащую к семейству экстрадиолдиоксигеназ I типа (DhbA). DhbA гомологичен PsbC2, 2,3-дигидрокси- p-кумат-3,4-диоксигеназе из R. palustris (идентичность 56%) (42), а также родственен другим белкам, ранее идентифицированным как 2. ,3-дигидрокси- p -кумат-3,4-диоксигеназы (18) ( и ). dhbB кодирует белок суперсемейства альдолазы II (cl00214), гомологичный белкам CmtD из Burkholderia xenovorans LB400 ({«type»:»entrez-protein»,»attrs»:{«text»:»YP_557489″,» term_id»:»283″,»term_text»:»YP_557489″}}YP_557489; 55% идентичности) и Pseudomonas putida F1 ({«type»:»entrez-protein»,»attrs»:{«text»:» AAB62290″,»term_id»:»1263185″,»term_text»:»AAB62290″}}AAB62290; идентичность 54%), которые катализируют декарбоксилирование продукта расщепления кольца 2,3-дигидрокси- p -кумата (2- гидрокси-3-карбокси-6-оксо-7-метилокта-2,4-диеноат) в 2-гидрокси-6-оксо-7-метилокта-2,4-диеноат (18).DhbB отдаленно связан с 3,4-дигидроксифталат-2-декарбоксилазами (18) (и). Предполагаемые функции и филогенетическое родство DhbA и DhbB позволяют предположить, что эти ферменты участвуют в деградации карбоксилированного катехола, который подвергается расщеплению кольца с последующим декарбоксилированием.

Химерная организация кластера генов dhb . Организация и сравнение кластера генов dhb P. reinekei MT1 с кластером cmt P.putida F1 и кластер генов катаболизма фенола, включающий мета- генов пути расщепления C. necator h26. Гены с высоким сходством с генами кластера dhb выделены жирным шрифтом. HMS, 2-гидроксимуконовый полуальдегид; HCOMODA, 2-гидрокси-3-карбокси-6-оксо-7-метилокта-2,4-диеноат.

Таблица 3

Орфс и гены DHB Гена P. Reinekei P. Reinekei MT1 и окружающие регионы A

0 9.xylosoxidans A8 1 1 TA441
DHB Генный кластер
Связанные продукты Gene
Ген Размер продукта гена (аа) Предполагаемая функция продукта гена Название и размер (аа) Организм % аа идентичность Номер доступа(Ссылка)
dhbr 320 320 Transcrient типа Lysr CNE_BB1P12040 (301) C. Necator N-1 55 {«Тип»: «Entrez -Протеин «,» attrs «: {» текст «:» YP_004688643 «,» term_id «:» 339328951 «,» term_text «:» YP_004688643 «}} yp_004688643
Nahr (300) P. fluorescens Cg5 33 {«type»:»entrez-protein»,»attrs»:{«text»:»AAM09546″,»term_id»:»20067197″,»term_text»:»AAM09546 «}}AAM09546 (40)
dhbA 287 2,3-DHB 3,4-диоксигеназа AXYL_025 9053 9.540 9.530xylosoxidans A8 71 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_003978561″,»term_id»:»311105708″,»term_text»:»YP_003978561″}}YP_003978561
PsbC2 (283) R. palustris №. 7 56 {«type»:»entrez-protein»,»attrs»:{«text»:»BAA82122″,»term_id»:»5360706″,»term_text»:»BAA82122″}}BAA82122 (42 )
dhbB 233 2-гидрокси-3-карбоксимуконовая полуальдегиддекарбоксилаза AXYL_02526 (236)
65 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_003978562″,»term_id»:»311105709″,»term_text»:»YP_003978562″}}YP_003978562
P. putida F1 54 {«Тип»: «Entrez-белок», «attrs»: {«Текст»: «AAB62290» , «term_id»: «1263185», «term_text»: «aab62290»}} aab62290 (18)
DHBC DHBC 489 2-гидроксимузность полуалдегида дегидрогеназа H26_B0547 (492) C.necator h26 80 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_728709″,»term_id»:»116694498″,»term_text»:»YP_728709″}}YP_728709
Nahi (486) P. STUTZERI AN10 70550 70 {«Тип»: «Entrez-белок», «Attrs»: {«Текст»: «AAD02149» , «term_id»: «4104767», «term_text»: «AAD02149»}} aad02149 (6)
DHBD 260 2-осопент-4-Enoate Hydratase H26_B0548 (260) С.necator h26 77 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_728710″,»term_id»:»116694499″,»term_text»:»YP_728710″}}YP_728710
C. Testostroni Ta441 68 {«Тип»: «Энтуз-белок»: «Атрибусы»: {«Текст»: «Baa88502» , «term_id»: «6624272», «term_text»: «Baa88502»}} Baa88502 (4)
DHBE 266 4-оксалократонат декарбоксилаза H26_B0549 (262) C.necator h26 82 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_728711″,»term_id»:»116694500″,»term_text»:»YP_728711″}}YP_728711
Xyli (264) P. Putida MT2 63 {«Тип»: «Entrez-белок», «attrs»: {«Текст»: «AAA25693» , «term_id»: «150973», «term_text»: «AAA25693»}} AAA25693 (26)
DHBF 63 4-оксалократонат Tautomerase CNE_BB1P11970 (63) C.necator N-1 75 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_004688636″,»term_id»:»339328944″,»term_text»:»YP_004688636″} } YP_004688636
NaHJ (63) P. STUTZERI AN10 58 58 {«Тип»: «Entrez-белок», «attrs»: {«текст»: » Q9zi54 «,» term_id «:» 45593119 «,» term_text «:» Q9zi54 «}} Q9zi54 (6)
DHBG 312 Acetaldehyde dehydrogenase MHPF1 (312) P.putida GJ31 78 {«type»:»entrez-protein»,»attrs»:{«text»:»Q49KG0″,»term_id»:»122651556″,»term_text»:»Q49KG0″}}Q49KG0 (34)
DHBH 345 345 4-гидрокси-2-кетовалерные альдолазы Avin_42120 (340) A. Vinelandii DJ 88 {«Тип»: «Entrez- Белок «,» attrs «: {» текст «:» YP_002801314 «,» term_id «:» 226946241 «,» term_text «:» YP_002801314 «}} yp_002801314
Xylk (345) стр.putida mt2 86 {«type»:»entrez-protein»,»attrs»:{«text»:»P51019″,»term_id»:»1722895″,»term_text»:»P51019″}}P51019 (26)
130 130 Srosdraft_45540 (120) S. ROIDEUM DSM 43021 39 {«Тип»: «Entrez-белок», «Attrs «: {» текст «:» zp_04473974 «,» term_id «:» 229853976 «,» term_text «:» zp_04473974 «}} ZP_04473974 5974 ORF2 30276 302 Transcrience Transcrient 308) Pseudomonas reinekei MT1 66 {«type»:»entrez-protein»,»attrs»:{«text»:»ABH07018″,»term_id»:»111145986″,»term_text»: «ABH07018»}}ABH07018 (9)
HybH (231) P.aeruginosa JB2 52 {«type»:»entrez-protein»,»attrs»:{«text»:»AAC69490″,»term_id»:»3644004″,»term_text»:»AAC69490″}}AAC69490 (28)
orf3 312 Регулятор транскрипции LysR-типа Mmc1_0773 (315) Magnetococcus sp. штамм MC-1 51 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_864700″,»term_id»:»1173″,»term_text»:»YP_864700″}} YP_864700
A1S_2405 (306) А.baumannii ATCC 17978 36 {«type»:»entrez-protein»,»attrs»:{«text»:»ABO12824″,»term_id»:»193077926″,»term_text»:»ABO12824″}} ABO12824 (52)
6 253 6053 3 Arad_7279 (254) A. Radiobacter K84 51 {«Тип»: «Entrez-белок», » attrs «: {» текст «:» yp_002540411 «,» term_id «:» 222081048 «,» term_text «:» YP_002540411 «}} YP_002540411
Linc (250) S.paucimobilis 49 {«type»:»entrez-protein»,»attrs»:{«text»:»AAZ14097″,»term_id»:»70

7″,»term_text»:»AAZ14097″}}AAZ14097 ( 35)

ORF5 152 152 Гипотетический белок ARAD_7278 (151) A. Radiobacter K84 39 39 {«Тип»: «Entrez-белок», «attrs»: {«текст»: «YP_002540410», «term_id»: «222081047», «term_text»: «YP_002540»}} yp_002540410
ORF6 254 Короткие цепи дегидрогеназы Arad_7275 (256) А.radiobacter K84 57 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_002540408″,»term_id»:»222081045″,»term_text»:»YP_002540408″}}YP_002540408
ORF7 563 563 Гипотетический белок CNE_BB2P00960 (549) C. NUCATOR N-1 61 {«Тип»: «Entrez-белок», «attrs»: { «текст»: «YP_004682758», «term_id»: «339323865», «term_text»: «YP_004682758»}} YP_004682758
orf8 458 гипотетический белок CNE_BB2p00970 (460) С.necator N-1 65 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_004682759″,»term_id»:»339323866″,»term_text»:»YP_004682759″} }YP_004682759
orf9 366 Гипотетический белок {«type»:»entrez-protein»,»attrs»:5″5term_id»:4″,5″10968″,{«text»:»PRK1368″ «term_text»:»PRK13684″}}PRK13684 (360) P. fluorescens 49 {«type»:»entrez-protein»,»attrs»:{«text»:»BAD11010″,» term_id «:» 42517090 «,» term_text «:» Bad11010 «}} Bad11010
ORF10 831 RND Family Transporter CNE_BB2P00990 (813) C.necator N-1 68 {«type»:»entrez-protein»,»attrs»:{«text»:»YP_004682761″,»term_id»:»339323868″,»term_text»:»YP_004682761″} } YP_004682761
DHBI 276 276 2996 2-гидроксимуконом полуалдегиде гидролазу Davo_3786 (274) D. aromatica RCB 65 {«Тип»: «Entrez-белок», » Attrs »: {» текст «:» yp_286985 «,» term_id «:» 718 «,» term_text «:» YP_286985 «}} YP_286985
TADF (286) D.tsuruhatensis AD9 62 {«type»:»entrez-protein»,»attrs»:{«text»:»AAX47253″,»term_id»:»61611861″,»term_text»:»AAX47253″}}AAX47253 (36)

Дендрограммы, показывающие родство ферментов Dhb. (А) экстрадиолдиоксигеназы; (B) декарбоксилазы семейства альдолаз класса II, действующие в ароматическом метаболизме; (C) 2-оксопент-4-еноатгидратаза и 4-оксокротонатдекарбоксилаза; (D) ацетальдегиддегидрогеназа; и (Е) 2-гидроксимуконовые полуальдегидгидролазы.Эволюционная история была выведена с использованием метода объединения соседей и модели p-расстояния после выравнивания последовательностей с использованием MUSCLE (19). Все позиции, содержащие пробелы в выравнивании и отсутствующие данные, исключались только при попарном сравнении последовательностей. Филогенетические анализы проводились в MEGA5 (53).

Следующие ОРС ( dhbCDEFGH ) кодируют ферменты, гомологичные ферментам, участвующим в путях расщепления катехола мета , и, по-видимому, кодируют HMS-дегидрогеназу (DhbC), 2-оксопент-4-еноатгидратазу (DhbD), 4-оксалокротонатдекарбоксилазу ( DhbE), 4-оксалокротонаттаутомераза (DhbF), ацетальдегиддегидрогеназа (DhbG) и 4-гидрокси-2-кетовалератальдолаза (DhbH) соответственно ( и и ).Такие ферменты необходимы для деградации катехинов через так называемую дегидрогеназную ветвь пути расщепления мета , который направляет катехины через ГМС, 2-гидроксимуконат и 4-оксалокротонат в 2-оксопент-4-еноат (12). 25).

Предлагаемый путь деградации 2,3-ДГБ с помощью P. reinekei MT1. Также показан предполагаемый путь метаболизма 2,3-дигидрокси- p-кумата. Используемые ферменты включают следующие: DhbA, 2,3-DHB 3,4-диоксигеназа; DhbB, 2-гидрокси-3-карбоксимуконовая полуальдегиддекарбоксилаза; DhbC, 2-гидроксимуконовая полуальдегиддегидрогеназа; DhbD, 2-оксопент-4-еноатгидратаза; DhbE, 4-оксалокротонатдекарбоксилаза; DhbF, 4-оксалокротонатизомераза; DhbG, ацетальдегиддегидрогеназа; DhbH, 4-гидрокси-2-оксовалератальдолаза; и DhbI, 2-гидроксимуконовая полуальдегидгидролаза.

Это отличается от организации кластеров генов для деградации 2,3-дигидрокси- p -кумата P. putida F1 (18) и B. xenovorans LB400 ({«тип»:» entrez-нуклеотид»,»attrs»:{«текст»:»CP000270″,»term_id»:»338″,»term_text»:»CP000270″}}CP000270; от Bxe_A3546 до Bxe_A3554), где гены, кодирующие HMS-дегидрогеназу, 4- оксалокротонатдекарбоксилаза и 4-оксалокротонаттаутомераза отсутствовали (). Альтернативная ветвь деградации катехолов включает гидролазу HMS (25).Деградация по этой ветви необходима для деградации 3-алкилзамещенных катехолов, где продуктом расщепления кольца является кетон, который не может быть подвергнут дегидрированию, как при деградации 2,3-дигидрокси- p -кумата () ( 18).

Ген, кодирующий предполагаемую гидролазу HMS (DhbI), локализован в 10,7 т.п.о. ниже по течению от dhbH (). DhbI явно отличается от других гидролаз, таких как CmtE, которая участвует в трансформации 2-гидрокси-6-оксо-7-метилокта-2,4-диеноата (идентичность от 24 до 27%) (18), BphD, трансформирующая 2-гидрокси-6-фенилгекса-2,4-диеноат (33), или MhpC, превращающийся в 2-гидрокси-6-кетонона-2,4-диендиовую кислоту (до 35% идентичности) (16).Однако это связано с HMS-гидролазами путей расщепления катехола мета , такими как XylF P. putida mt2 (> 50% идентичности) (31) ( и ).

10 ORF, локализованных между dhbH и dhbI , не проявляли очевидной функции, связанной с разложением ароматических соединений. Интересно, что гены, сходные с orf4 по orf6 , наблюдались в идентичном расположении в геномах Agrobacterium radiobacter K84 ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NC_011983 «,»term_id»:»222080781″,»term_text»:»NC_011983″}}NC_011983; от Arad_7275 до Arad_7279), в то время как гены, связанные с orf7 по orf10 , присутствуют в Methylibium Petrolophilum «PM1 ({«type :»entrez-protein»,»attrs»:{«text»:»YP_001020161″,»term_id»:»124266157″,»term_text»:»YP_001020161″}}YP_001020161; от Mpe_A0964 до Mpe_A0967) и Leptothrix choldni SP- 6 ({«type»:»entrez-protein»,»attrs»:{«text»:»YP_0017«,»term_id»:»171058844″,»term_text»:»YP_0017«}}YP_0017; от Lcho_2162 до Lcho_2165).Тем не менее, они отделены от кластеров генов meta -pathway, присущих этим штаммам (и ).

Ген

dhbA необходим для роста P. reinekei MT1 на 2,3-дигидроксибензоате.

Основываясь на предполагаемой функции и филогении ферментов, кодируемых кластером dhb , а также на организации кластера генов, был сделан вывод, что этот кластер может быть вовлечен как в 2,3-дигидрокси- p расщепление -кумата и 2,3-ДГБ.Поскольку P. reinekei MT1 не способен расти на p -кумате, была проанализирована роль кластера dhb в деградации 2,3-DHB. Была выполнена направленная делеция dhbA , гена, кодирующего предполагаемую 2,3-DHB 3,4-диоксигеназу. MT1Δ dhbA не мог расти на 2,3-DHB как на единственном источнике углерода, что подтверждает решающую роль DhbA в деградации этого соединения.

DhbA катализирует расщепление кольца 2,3-дигидроксибензоата.

Ранее было описано, что трансформация 2,3-DHB клеточными экстрактами штаммов Pseudomonas , разлагающих 2,3-DHB, приводит к образованию HMS путем расщепления кольца и последующего декарбоксилирования (3, 45).Трансформация 2,3-DHB рекомбинантным DhbA привела к образованию продукта с максимумом поглощения (λ max ) 343 нм (), который явно отличается от такового для HMS (λ max 375 нм). но аналогично 2-гидрокси-3-карбокси-6-оксо-7-метилокта-2,4-диеноату, образованному расщеплением экстрадиольного кольца 2,3-дигидрокси- p -кумата (λ макс. из 346 нм) (18). Это указывает на то, что декарбоксилирование продукта расщепления кольца 2,3-DHB не происходит спонтанно, а, скорее всего, катализируется DhbB.

Превращение 2,3-ДГБ с помощью экстрактов E. coli JM109(pGC23O) и структура продукта расщепления кольца, определенная анализом 1 H ЯМР. Образец для фотометрического анализа содержал 50 мМ фосфатного буфера (рН 8,0) и 50 мкМ 2,3-ДГБ. Спектры записывали перед добавлением 15 мкл клеточного экстракта в течение 20 мин с 2-минутными интервалами. 1 Н ЯМР-анализ проводили после трансформации 1 мМ 2,3-ДГБ в 50 мМ фосфатного буфера (рН 8,0).

Для определения структуры продукт реакции, образованный рекомбинантным DhbA, анализировали с помощью 1 H ЯМР-анализа ().В продукте присутствовали только два связанных олефиновых протона (δ 6,69 и 7,52 м.д.), за исключением того, что в качестве продукта произошло 1,2-диоксигенирование с 2-гидрокси-6-оксогепта-2,4-диеноатом. Вицинальная связь 14,5 Гц, наблюдаемая для олефинового звена, характерна для конфигурации -транс- в системе с открытой цепью (46). Альдегидный протон резонирует при 9,03 м.д. и показывает связь 8,9 Гц с олефиновым протоном при 6,69 м.д. Эти характеристики соответствуют структуре 2-гидрокси-3-карбоксимуконата и являются доказательством того, что DhbA катализирует 3,4-диоксигенирование и что декарбоксилирование продукта расщепления кольца не происходит спонтанно.

DhbA специализируется на расщеплении 2,3-дигидроксибензоатного кольца.

Активность рекомбинантного DhbA оценивали в отношении различных дигидроксилированных ароматических соединений (). Самый высокий уровень активности наблюдался у 2,3-ДГБ. 2,3-Дигидрокси- p -кумат также трансформировался со скоростью приблизительно 30% от скорости превращения 2,3-ДГБ. Из других протестированных субстратов трансформировался только катехин. Анализ кинетических параметров показал K m для 2,3-DHB 2.9 мкМ, что примерно вдвое меньше, чем для 2,3-дигидрокси- p -кумата. Соответственно, сравнение констант специфичности ( V max / K m ) показало, что 2,3-DHB является предпочтительным субстратом ().

Таблица 4

Подложка специфичности DHBA

0 9 3.8
SP ATT SP ACT SP ACT A / G белка K M (мкМ) V MAX (ед/г белка) V max / K m (относительно)
2,3-DHB
2,9 ± 0.2 2,9 ± 0.2 96,3 ± 2.0 1
2,3-DH- P -Cumate 32.7 5.9 ± 0,7 32,7 ± 1,0 0,167
Catechol 6,8 ND б ND ND
3-Methylcatechol <1 ND ND ND
Protocatechuate <1 ND ND ND ND
Pyrogallol <1 ND ND ND ND

Трансформация 2,3-дюйма по клеткам экстрактов 2,3-DHB, выращенных р .reinekei MT1 показал превращение в продукт с λ max 375 нм без каких-либо признаков накопления 2-гидрокси-3-карбоксимуконового полуальдегида (λ max , 343 нм; см. выше). В соответствии с этим 2-гидрокси-3-карбоксимуконовый полуальдегид быстро трансформировался экстрактом с V max 731 ± 17 ед/г белка в продукт с максимумом поглощения при 375 нм, что свидетельствует о декарбоксилировании продукта до форма ГМС. Таким образом, наблюдаемая скорость образования ГМС из 2,3-ДГБ 37 ед/г белка клеточными экстрактами, по-видимому, ограничивается 2,3-ДГБ-диоксигеназой и указывает на активность этого белка в клеточном экстракте.В то время как активность HMS-гидролазы была ниже предела обнаружения, HMS-дегидрогеназа была активна в клеточных экстрактах ().

Таблица 5

Фермент деятельности в клеточных экстрактах P. Reinekei MT1 Выросли на 2,3-DHB

Enzyme SP ACT SP ACT A (U / G белок) K M M (мкМ) V Max (U / G белка)
2,3-DHB DHBEGENASE 2,3-DHB 37 ND b ND
ГХМС декарбоксилаза ГХМС 640 0.74 ± 0.05 731 ± 17 731 ± 17
HMS Dehydrogenase HMS 141 141 141 1,2 ± 0,2 170 ± 7
HMS Hydrolase Hopda <5 ND ND

ПЦР-анализ транскриптов MT1 в реальном времени.

Чтобы подтвердить, что генов dhb специфически транскрибируются во время деградации 2,3-DHB, во время роста измеряли накопление транскриптов dhbA , dhbE и dhbH , явно локализованных в одном и том же кластере катаболических генов. 2,3-DHB, а также на глюконате в качестве неиндуцирующего отрицательного контроля.Чтобы проанализировать, насколько далеко были транскрибированы гены ниже кластера генов dhb , в анализ также были включены orf4 и dhbI . ммл , кодирующий 4-метил-3-оксоадипатенол-лактонгидролазу, ключевой фермент в расщеплении метилароматических соединений с помощью P. reinekei MT1 (38), использовали в качестве отрицательного контроля. Уровни транскриптов во время роста на глюконате обычно были низкими (<100/нг кДНК; ) для всех генов кластера генов dhb , и только ммл показали несколько более высокие уровни транскриптов.Значительно повышенные уровни транскриптов dhbA , dhbE и dhbH наблюдались в клетках, выращенных на 2,3-DHB. Когда относительные уровни экспрессии между геном-мишенью и референсным геном ( rpsL ) сравнивали с уровнями в неиндуцирующих условиях (при соотношении 1), наблюдались приблизительно в 500–1500 раз более высокие уровни транскриптов (1). Напротив, уровни экспрессии orf4 и dhbI повышались только примерно в 15 раз, тогда как mmlL не индуцировалась ().

Абсолютный (вверху) и относительный (внизу) уровни экспрессии катаболических генов в выращенных на 2,3-DHB клетках P. reinekei MT1, определенные с помощью количественной ПЦР в реальном времени. Количество транскриптов/нг кДНК в глюконате (светло-серые столбцы) и клетках, выращенных на 2,3-DHB (темно-серые столбцы), показано (вверху). Столбики погрешностей указывают на стандартные отклонения. Значения относительной экспрессии (внизу) представляют собой n -кратных изменений отношения экспрессии генов между геном-мишенью и эталонным геном ( rpsL ) по сравнению с экспрессией в неиндуцирующих условиях (для rpsL это отношение было установлено как 1). ).

ОБСУЖДЕНИЕ

На протяжении всего этого исследования мы смогли продемонстрировать, что P. reinekei MT1 способен расщеплять 2,3-DHB, используя путь расщепления мета , кодируемый кластером dhb . DhbA катализирует расщепление кольца 2,3-DHB и представляет собой экстрадиолдиоксигеназу I типа из семейства вицинальных кислородных хелатов (21). Это семейство состоит из ферментов, которые хорошо известны тем, что участвуют в расщеплении катехолов или алкилзамещенных катехолов, а также бициклических дигидроксилированных ароматических соединений, таких как 2,3-дигидроксибифенил (25).Ферменты, действующие на карбоксилированные катехолы, такие как CmtC P. putida F1 (18) или DhbA, описанные здесь, по-видимому, образуют новые ответвления в филогении экстрадиолдиоксигеназ I типа (20). Остается открытым вопрос, обладают ли ферменты этой ветви, как правило, широкой субстратной специфичностью и принимают ли по-разному замещенные 3-карбоксикатехолы в качестве субстратов, как указано для фермента p -выращенного на цимене P. putida PL-W, и как показано здесь для DhbA. уточнить (13). Направление продуктов расщепления кольца 2,3-DHB и 2,3-дигидрокси- p -кумата в хорошо задокументированные пути расщепления мета катализируется декарбоксилазами семейства альдолаз класса II, образуя HMS или 2 -гидрокси-6-оксо-7-метилокта-2,4-диеноат соответственно.Исследование опубликованных в настоящее время геномов показало, что по крайней мере A. radiobacter K84, Ralstonia solanacearum GMI1000, Achromobacter xylosoxidans A8 и Cupriavidus necator N-1 также несут оба гена () и также могут быть способны к деградации карбоксизамещенные катехины.

После экстрадиолового расщепления продукты расщепления кольца обычно процессируются одной из двух различных мета ветвей пути расщепления. Если продукт расщепления кольца представляет собой альдегид (HMS в случае 2,3-DHB), путь протекает через дегидрогеназную ветвь через дегидрирование, изомеризацию и декарбоксилирование (), что приводит к образованию 2-оксопента-4-еноата. в качестве центрального промежуточного звена.Напротив, если продукт расщепления кольца представляет собой кетон (2-гидрокси-6-оксо-7-метилокта-2,4-диеноат в случае метаболизма 2,3-дигидрокси- p -кумата), путь протекает через гидролитическая ветвь, где кетон гидролизуется с образованием 2-оксопента-4-еноата и кислоты. Дальнейшая трансформация 2-оксопента-4-еноата, общего интермедиата гидролитической и дегидрогеназной ветвей, протекает с участием 2-оксопент-4-еноатегидратазы, приводя к образованию 4-гидрокси-2-оксовалерата, который затем превращается в пируват и ацетальдегид с помощью 4-гидрокси-2-оксовалератальдолазы (51).Наконец, эти продукты могут войти в цитратный цикл ().

Различные мета кластеры генов пути расщепления были описаны в литературе. Наиболее широко изученный путь расщепления мета расположен на плазмиде TOL pWW0 (8, 23), которая содержит гены, кодирующие ферредоксин ( xylT ), катехол 2,3-диоксигеназу (C23O) ( xylE ), а также гидролитическую ( xylF ) и дегидрогеназную ( xylG , xylH и xylI ) ветви пути расщепления мета (22, 50).Хотя подобная структура сохраняется в различных кластерах генов пути расщепления катехина мета , некоторые другие кластеры, такие как те, которые участвуют в деградации бифенила, которые требуют гидролитической ветви, лишены генов, кодирующих ветвь дегидрогеназы (30). Точно так же кластеры генов деградации 2,3-дигидрокси- p -кумата как P. putida F1, так и B. xenovorans LB400 лишены генов, кодирующих ферменты этой ветви, и поэтому не подходят для обеспечения 2, Деградация 3-DHB ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»CP000270″,»term_id»:»338″,»term_text»:»CP000270″}}CP000270; Bxe_A3546 до Bxe_A3554) (18).Тот факт, что, как и CmtC-подобные экстрадиолдиоксигеназы (), CmtE-подобные гидролазы составляют отдельную ветвь в их филогении (), указывает на коэволюцию генов кластеров генов cmt для деградации p -кумата.

Напротив, кластер dhb , описанный здесь, скорее всего, представляет собой кластер химерных генов, состоящий из генов, кодирующих ферменты, специализированные для направления 2,3-DHB в путь расщепления meta , кластеризованный с генами, очень похожими на гены архетипа meta — кластеры генов пути расщепления.В то время как DhbC, DhbD и DhbE наиболее тесно связаны с белками, кодируемыми meta -кластерами пути расщепления, участвующими в деградации фенола бактериями Burkholderiales , в частности C. necator h26 (от h26_B0546 до h26_B0552), Verminephrobacter eisenia -2 (от Veis_2781 до Veis_2787), Leptothrix cholodnii SP-6 (от Lcho_3340 до Lcho_3356) или Methylibium petrophilum PM1 (от Mpe_A2266 до Mpe_A2277) (), DhbG и DhbH более тесно связаны с ферментами, кодируемыми 23- кластеры катаболических генов дигидроксифенилпропионата (), что, возможно, также указывает на различное происхождение этих генов.

Исследование бактериальных геномов показало, что кластеры катаболических генов со структурой, идентичной структуре кластера генов dhb , присутствуют у R. solanacearum GMI1000 (от RSp0888 до RSp0895), C. necator N-1 (1CNE_BB01p до CNE_BB1p13240 и от CNE_p112030 до CNE_p12140) и A. radiobacter K84 (от Arad_7255 до Arad_7275). Как и в P. reinekei MT1, оба этих кластера генов лишены гена, кодирующего гидролазу HMS.Подобные кластеры генов также присутствуют в геномах Achromobacter xylosooxidans A8 и Agrobacterium radiobacter K84. Таким образом, можно предположить, что эти штаммы обладают способностью минерализовать 2,3-DHB и что кластер генов типа dhb хорошо подходит для минерализации 2,3-DHB и, таким образом, широко распространен среди бактерий.

Хотя ген, кодирующий гидролазу HMS, отсутствует в кластере генов P. reinekei MT1 dhb , такой ген, названный dhbI , был расположен поблизости, и его экспрессия наблюдалась во время роста на 2, 3-ДХБ.Кодирует ли dhbI функциональную гидролазу, которая служит для расширения диапазона субстратов, которые могут использоваться P. reinekei MT1, из которого он мог быть рекрутирован, и образуют ли вместе orf4 orf10 транскрипционную единицу с dhbI находятся под следствием. Таким образом, наблюдаемая генная организация P. reinekei MT1 может все еще находиться в процессе эволюции, чтобы обеспечить деградацию различных экологически значимых карбоксилированных ароматических соединений.

Добавить комментарий

Ваш адрес email не будет опубликован.