Длина ружья мр 155 в сборе: Купить Ружье МР-155 к.12/76 L750 мм пластик д/н цветн.мушка по выгодной цене

Содержание

Дробовик МР-155 (Россия / СССР)



МР-155
с пластмассовой фурнитурой

В 1999-2000 годах на Ижевском Механическом заводе было создано самозарядное гладкоствольное ружье МР-153, где с 2000 года было налажено его серийное производство. Это оружие быстро завоевало популярность, как в России, так и за рубежом. В период с 2000 года по 2010 год было выпущено порядка 500000 единиц МР-153. За время производства этого оружия накопилось большое количество клиентских пожеланий и конструкторских идей улучшения ружья, поэтому было принято решение по разработке нового самозарядного ружья на смену МР-153.

В результате этого в начале 2010-х годов конструкторами Ижевского Механического завода была создана новая модель самозарядного гладкоствольного ружья, получившего обозначение МР-155.

Калибр1220
Патронник, мм768976
Длина, мм1140,
1190,
1240,
1280
1140,
1190,
1240
Длина ствола, мм610,
660,
710,
750
610,
660,
710
Диаметр канала, мм18. 415.7
Вес без патронов, кг3.1 — 3.852.8 — 3.3
Магазин, кол. патронов1, 2,
4, 5,
6, 9
1, 2,
3, 4,
5, 8
1, 2, 4

МР-155 является продолжением линейки гладкоствольных газоотводных ружей Ижевского завода, а именно дробовика МР-153, в котором исправили недостатки, а также внесли изменения и усовершенствования. Конструкторы облегчили ружье за счет размещения автоматического регулятора импульса двигателя на газовом поршне, позволяющим сбрасывать избыточное давление пороховых газов из камеры, а также использования прицельной планки арочного типа. Эти изменения позволили не только снизить вес, но и добиться лучшей сбалансированности ружья. Для ружей с калибром 12/76 применили укороченную ствольную коробку, что дополнительно снизило вес. Множество улучшений и изменений затронули ударно-спусковой и предохранительный механизмы. Новый спусковой крючок стал шире и удобнее, а на передней внутренней стенке спусковой скобы разместился указатель взведения курка.

Кнопка удерживателя также была укрупнена и стала удобнее. Увеличенный предохранитель, находящийся у основания спусковой скобы, можно установить на любой стороне оружия. Кроме того, ружье получило отсекатель, способный отключать подачу патронов из магазина и быстро произвести дозарядку другим патроном. Также была добавлена возможность установки оптических и коллиматорных прицелов, а сам механический прицел был изменен, получив фиберглассовую светособирающую мушку. Эргономику ружья улучшили за счет новой конструкции затылка-амортизатора и возможности регулировки понижения гребня приклада.

Это оружие разработали для различных видов охоты, занятий спортом, а также для самообороны граждан и защиты их имущества. В 2011 году дробовик впервые был представлен широкой публике и в том же году было налажено его серийное производств.

В зависимости от калибра и длины патронника ружье МР-155 имеет три исполнения: 1) 12х76 мм, 2) 12х89 мм, 3) 20х76 мм. Для стрельбы из ружья с длиной патронника 89 мм возможно применение патронов с длиной гильзы от 70 до 89 мм, а с длиной патронника 76 мм — патронов с длиной гильзы от 70 до 76 мм.



Сборочные единицы и детали. Схема устройства ружья МР-155:
1 — Сменное дульное сужение; 2 — Ствол; 3 — Коробка; 4 — Кольцо поршневое
внутреннее; 5 — Гайка; 6 — Хомут антабки; 7 — Кольцо антабки; 8 — Винт;
9 — Гайка-удлинитель; 10 — Пружина удлинителя; 11 — Переходник удлинителя;
12 — Стакан; 13 — Пружина магазина; 14 — Подаватель; 15 — Трубка магазина;
16 — Поршень; 17 — Гайка; 18 — Антабка приклада; 19 — Клапан; 20 — Кольцо
клапана; 21 — Пружина клапана; 22 — Гайка регулировочная; 23 — Фиксатор;
24 — Пружина возвратная; 25 — Кольцо; 26 — Буфер; 27 — Рама затворная;
28 — Штифт вставки; 29 — Шарик; 30 — Пружина ползуна; 31 — Толкатель;
32 — Рукоятка; 33 — Затвор; 34 – Извлекатель; 35 — Пружина извлекателя;
36 — Гнеток извлекателя; 37 — Выбрасыватель; 38 — Штифт ударника; 39 — Шайба;
40 — Пружина ударника; 41 — Ударник;42 — Штифт задний; 43 — клин;
44 — Основание ударно-спускового механизма; 45 — Предохранитель;
46 — Гнеток предохранителя;47 — Пружина предохранителя; 48 — Спусковой
крючок; 49 — Ось спускового крючка; 50 — Ось разобщителя; 51 — Разобщитель;
52 — Пружина разобщителя; 53 — Курок; 54 — Ось курка; 55 — Боевая
пружина; 56 — Толкатель курка; 57 — Удерживатель; 58 — Пружина
удерживателя; 59 — Шептало; 60 — Пружина шептала; 61 — Ось шептала;
62 — Лоток; 63 — Серьга; 64 — Ось; 65 — Ось с кольцом передняя; 66 — Ось с
кольцом задняя; 67 — Кольцо; 68 — Шайба упорная; 69 — Перехватыватель;
70 — Пружина перехватывателя; 71 — Ось; 72 — Кнопка перехватывателя;
73 — Пружина кнопки перехватывателя; 74 — Цевье; 75 — Корпус фиксатора;
76 — Пружина фиксатора; 77 — Фиксатор; 78 — Втулка цевья; 79 — Приклад;
80 — Затыльник амортизатор; 81 — Опора затыльника; 82 — Шуруп; 83 — Винт;
84 — Шайба; 85 — Вкладыш; 86 — Отсекатель; 87 — Пружина отсекателя;
88 — Винт; 89 — Штифт передний.

Конструктивно МР-155 представляет собой самозарядное газоотводное гладкоствольное ружье и состоит из следующих основных узлов:

  • ствола с газовой камерой;
  • коробки с подствольным магазином и перехватывателем;
  • подвижной системы ружья, в которую входят поршень с регулятором скорости отката подвижных частей; рама затворная в сборе, рукоятка перезаряжания и затвор в сборе с клином;
  • возвратной пружины;
  • ударно-спускового механизма;
  • приклада;
  • цевья.

Работа механизма перезаряжания ружья производится автоматически за счет энергии пороховых газов, отводимых из канала ствола в рабочую камеру газового двигателя, и за счет энергии возвратной пружины, расположенной на трубке магазина.



МР-155. Ствол снят

Автоматический регулятор скорости отката подвижных частей смонтирован на поршне и позволяет применять патроны с различными характеристиками, а также компенсировать влияние температурных условий эксплуатации ружья за счет сброса избыточного давления пороховых газов из камеры в атмосферу.


Вид на затвор

Затвор продольно скользящий, запирание ствола осуществляется боевым упором клина, расположенного в затворе и поднимающегося в крайнем переднем положении при помощи затворной рамы.

Ударно-спусковой механизм смонтирован на отдельном основании и позволяет производить только одиночные выстрелы. Кнопочный предохранитель, расположенный в основании УСМ в задней части предохранительной скобы, может быть установлен на любой стороне оружия.

Ружье имеет механизм задержки затвора в заднем положении после израсходования патронов.

Питание оружия боеприпасами осуществляется из трубчатого подствольного магазина. Емкость стандартного магазина 4 патрона калибра 12/76 или 3 патрона калибра 12/89. Вместимость магазина может быть уменьшена до одного или двух патронов за счет установки ограничителя в трубку магазина, либо увеличена до 9 и 8 патронов при использовании гайки-удлинителя.



Вид на элементы управления


Вид на механизм отсечки патронов

В зависимости от исполнения ружье может быть с механизмом отсечки патронов в магазине и без него. Механизм отсечки патронов в магазине при его включении исключает подачу патронов из магазина. После каждого выстрела затвор должен останавливаться в крайнем заднем положении. После нажатия на кнопку удерживателя и отведения затвора в крайнее заднее положение без выстрела затвор также должен остановиться в крайнем заднем положении. Это облегчает замену патрона уже находящегося в патроннике, а также дает возможность стрельбы патронами, отличающимися снаряжением от патронов, находящихся в магазине.


Вид на затыльник-амортизатор

Ружье может быть изготовлено в исполнении для стрелка-правши — с рукояткой перезаряжания и окном для выброса гильзы справа, и стрелка-левши — соответственно рукоятка перезаряжания и окно для выброса гильзы находятся слева.

Конструкция ружья обеспечивает взаимозаменяемость стволов, что позволяет заменить или установить дополнительный ствол без выполнения каких-либо доводочных операций. Стволы рассчитаны на использование как стальной, так и свинцовой дроби. В зависимости от конструкции и размеров дульных сужений, ружье имеет три исполнения: 1) с постоянным дульным сужением; 2) со сменными дульными сужениями для свинцовой дроби; 3) со сменными дульными сужениями для стальной дроби.

Для повышения коррозионной стойкости канал и патронник ствола, а также детали газового двигателя (поршень, газовая камера) и наружная поверхность трубки магазина хромированы.


Вид на дульный срез и мушку

Цевье и приклад могут быть изготовлены из дерева, либо из ударопрочной пластмассы. Приклад оснащен мощным резиновым затыльником-амортизатором. Вертикальный и горизонтальный отводы приклада могут регулироваться с помощью сменных вкладышей, устанавливаемых между задним торцем ствольной коробки и прикладом. Ружье в исполнении 12 калибра может оснащаться пистолетной рукояткой или складным прикладом.

Прицельные приспособления состоят из прицельной планки на стволе или из регулируемого целика и мушки на стволе. Ружье с прицельной планкой может быть дополнительно укомплектовано съемными регулируемым целиком и мушкой.

В целом МР-155 представляет собой легкое, комфортабельное полуавтоматическое ружье. Оно отличается прикладистостью и хорошим балансом. Удобно, как для правши, так и для левши. Автоматика отличается надежностью и «всеядностью», а механизм отсечки, позволяет отключать подачу из магазина и быстро произвести выстрел другим патроном, чем те, которыми снаряжен магазин. Из ружья возможна стрельба патронами, снаряженными не только свинцовой, но и стальной дробью.



МР-155
с деревянной фурнитурой

Ружье МР-155 12/76 Профи, L=750 мм

Ружье МР-155 12/76 Профи, L=750 мм.

МР-155 представляет собой гладкоствольное самозарядное ружье российского производства, предназначенное для спортивной стрельбы, самообороны, охраны, а так же для любительской и профессиональной охоты. Ружье отличает исполнение в улучшенном дизайне Профи.

Особенности:

  • — стрельба ведется патронами калибра 12/76, магазин вмещает в себя 4+1 патрон, имеет механизм отсечки патронов;
  • — полная длина ружья не превышает 1290 мм, при этом его вес равен 3,2 кг; длина ствола, входящего в комплектацию, составляет 75 см;
  • — к основным частям ружья относятся: ствол с газовой камерой, коробка с подствольным магазином, подвижная система ружья, возвратная пружина, УСМ, приклад, цевье;
  • — УСМ смонтирован на отдельном основании;
  • — патронник, канал ствола, поршень, газовая камера, наружная поверхность трубки магазина хромированы;
  • — прицельные приспособления представлены мушкой, для установки оптики предусмотрена планка ласточкин хвост;
  • — для обеспечения безопасности ружье оснащено кнопочным предохранителем;
  • — цевье и приклад ружья изготовлены из отборной высококачественной древесины ореха;
  • — в комплекте 5 дульных насадок, 4 проставки.
Как купить ружье МР-155 12/76 Профи L=750 мм?

Предупреждаем! Лицензионные товары не доступны к покупке через интернет-магазин. Приобрести лицензионный товар Вы можете в нашем магазине Air-Gun.ru только посредством самовывоза. Квалифицированный персонал даст полную консультацию по изделию, уходу за ним и ответит на все интересующие Вас вопросы.
Обращаем внимание, что для приобретения огнестрельного оружия и патронов необходимо предоставить лицензию! Ознакомиться с правилами и порядком получения Вы можете в разделе Лицензия.

Видео предоставлено Калашников Media.

Охотничье ружье МР-155 пластик, L-710


Калибр 12х76

Длина ствола 710 мм

Вес — 3,1 кг

Приклад  и цевье — пластик

Модернизированная модель  гладкоствольного охотничьего российского ружья МР-153

 Модификации отличаются длинной ствола и материалами приклада ложи и цевья:

 МР-155 710мм 

МР-155 750мм, 

МР-155 710мм «Нева Классик» 

  МР-155 750мм «Нева Классик»


Магазин ружья вмещает в себя 4 патрона. Автоматика работает за счет отвода пороховых газов.

 Безопасность осуществляется, удобным ручным кнопочным предохранителем,  для левшей можно изменить последовательность включения/выключения.

Улучшена эргономика, за счёт модернизации конструкции затылка-амортизатора. Был уменьшен ход спускового крючка. 

Появилась возможность установки различных прицельных приспособлений как коллиматорных так и оптических. В МР-155 добавлена возможность позволяющая отключить подачу патрон из магазина, при необходимости быстрой смены боеприпаса.

 Ижевский механический завод производит охотничьи ружья данной модели МР-155 для стрелков-левшей.

Данная модель имеет пластиковое цевьё и приклад.

Из достоинств данного ружья можно выделить:

небольшая масса.
возможность установки различных прицельных приспособлений.
удачная эргономика.
надёжность.
существует вариант оружия для левшей.

КУПИТЬ В СПб

Образец предоставлен:

«Ваффен Бутик, магазин охотничьих принадлежностей»

Санкт-Петербург, Александра Блока, 5 
Телефон: +7 812 495-27-48 

www.tirspb.ru 
vk.com/spbtir 

Особая благодарность: 
Станиславу Николаевичу Татарникову

МР-155, карабин, гладкоствольное оружие — Охота Рыбалка

МР-155 К — новая разработка Ижевского механического завода. Надежная высокоточная винтовка, отличающаяся доступной стоимостью и необычным дизайном в стиле милитари.

Рождение полуавтоматической винтовки МР-153 в свое время наделало много шума. На рынке вооружений России это была единственная пушка, позволяющая использовать любые боеприпасы с длиной гильзы от 70 до 89 мм. Оружие получило множество наград и производилось более 10 лет.

Однако рынок вооружений не статичен. А самая продвинутая модель может стать еще лучше. В итоге Ижевский механический завод в 2010 году начал выпуск новой модели МП-155 К.

.
Обзор ружья МП-155 К

МР-155 К, а точнее вся линейка МР-155, выпускаемая под торговой маркой Байкал. На пике разработки начались продажи МР-153. Важно было исправить недостатки модели, сохранив простоту конструкции и надежность.

Основным недостатком самозарядной винтовки был ее вес: на момент исследования спроса зарубежные аналоги такого типа имели массу от 3,1 до 3,3 кг, в то время как МР-153 без боеприпасов весила не менее 3,6 кг. Кроме того, отсутствие балансировки и таких опций, как возможность регулировки приклада и отсутствие ремней под оптическим прицелом, значительно снизили его конкурентоспособность.

Все эти недостатки исправлены в новой линейке. Что касается МР-155, то здесь работали не только конструкторы, но и конструкторы. Новая модель имеет оригинальный дизайн в стиле «милитари», разработанный специально для привлечения стрелков нового поколения, достаточно требовательных к конструкции огнестрельного оружия.

Основные элементы конструкции МР-155 К аналогичным механизмам МР-155: двигатель газовый, запорный механизм, регулировка импульса и так далее. При этом есть некоторые отличия: спусковой механизм в его основании, ленточный ткацкий станок и так далее.

Преимущества и недостатки

МР-155 К — гладкоствольное самозарядное ружье, предназначенное для охоты и спортивной стрельбы.Телефон доступен с болтами разной длины, что обеспечивает «всеядность» оружия: 76 и 70 для 12-го калибра.

  • Основными параметрами стрельбы для охотничьего ружья остаются точность и равномерность выстрела и острота. Целевая винтовка с 35 м, а затем с 50 м. Фигуры МР-155 полностью соответствуют ГОСТу, который требует:
    • отклонение СТП от центра вверх не более 150 мм;
    • отклонение вниз не более 50 мм;
    • отклонения вправо и влево — 75 мм.

Честно говоря, не со всеми боеприпасами винтовка может показывать должный результат. Охотникам рекомендуется поэкспериментировать с несколькими типами боеприпасов, чтобы найти тот, который дает наибольшую точность.

  • Перезарядка пистолета производится автоматически за счет срабатывания пороховых газов. Паро-автоматический регулируемый, что позволяет добиться достаточного уровня надежности при использовании любых фракций.
  • Питание от съемной коробки-накопителя. Емкость зависит от калибра — 4-5 патронов.
  • Ствольная коробка аналогична модели MP-155: верхняя часть выполнена из алюминиевого сплава, нижняя — из армированного волокном пластика. Последний включает приклад и пистолетную рукоятку. Как показывает опыт эксплуатации МР-155, этот вариант более чем надежен.
  • USM смонтирован на собственном основании, полностью съемный. Из ружья можно стрелять только одиночными выстрелами, что соответствует требованиям к охотничьему ружью. УСМ МП-155К оснащен неавтоматическим взрывателем. Особенностью модели МП-155 К является задержка затвора: она удерживает затвор в заднем положении при отсутствии патронов в магазине.
  • Ствол изготовлен из высококачественной оружейной стали. Канал ствольной коробки, камера и часть газового двигателя — газовая камера и поршень, хромированы. Таким образом предотвращается коррозия металла.

Стволы, изначально предназначенные для стрельбы свинцовой и стальной дробью. Ижевский завод (также известные карабины МП-94 «Экспресс», МР-43КН, МП-133, МП-233, МП-18МН, «Север», МП-161К, МР-142К, МР-143) предлагает сменные чоки различного номинала. дроссельная заслонка, увеличивающая дальность стрельбы.

  • Использование пластика в конструкции винтовки позволило снизить ее массу: без патронов весь модельный ряд, в том числе МР-155, весит в пределах 3,5 кг.
  • Винтовка поставляется с открытым прицелом, а целик имеет 2 возможных положения: открытый и оптический. Кроме того, МР-155 снабжен планкой для ткацкой планки, позволяющей устанавливать на винтовку оптический прицел и даже систему электронного наведения. Это необходимо для снятия съемной ручки для переноски винтовки.
  • Внешний вид изделия намного агрессивнее и брутальнее, чем у обычной винтовки Измена. Анодированный алюминий, черный пластик дополняют и подчеркивают дизайн в стиле «милитари».
  • Модели
  • доступны не только для правшей, но и для левшей с ручкой и перезарядкой окна, метая снаряды вправо и влево соответственно.

Недостатки винтовки МР-155 К следующему.

  • Масса, конечно, еще далека от идеала.Стрельба из рук довольно сложная, и после 5-6 часов ходьбы винтовка кажется слишком тяжелой.
  • Нерегулируемый приклад создает значительный дискомфорт.
  • Нет возможности переключаться между съемным и винтовочным магазином.
  • Design разработан для своей группы пользователей. Опытные охотники обычно отдают предпочтение более элегантной и легкой модели.

Фото ружья МР-155 К

Назначение
  • МР-155 К изначально рассматривался как охотничье ружье.Высокая точность и способность стрелять стальной дробью делают винтовку идеальной для охоты на средних животных и крупных птиц.
  • Расширение возможности установки оптического прицела. Однако для варминтинга это все же не годится.
  • Агрессивный дизайн делает оружие перспективным в качестве средства самообороны: поражение крупной дроби с расстояния 20-35 м остановит любого нападающего. Высокая точность обеспечивает попадание не менее 80% дроби.
  • Эта цифра позволяет использовать винтовку для спортивной и развлекательной стрельбы, при которой большой вес является преимуществом, так как снижает удар.

О спецверсии МП-155 пойдет речь ниже.

Сорта
  • МР-155 К выпускается под калибр 12, но с разной длиной патронника 70 и 76 мм. Это позволяет использовать патроны с гильзой разной длины.
  • Модель выпускается с разной длиной стволов — 510 и 610 мм.
Технические характеристики

Нестандартный карабин МР-155К по характеристикам аналогичен всей линейке МР-155.Дульная перетяжка для МР-155 К предназначена для свинцовой и стальной дроби, ушко обозначено соответствующим образом.

Настройки Значение параметра
Калибр 12
Длина камеры, мм 70, 76
Длина ствола, мм 510, 610
Среднее максимальное давление пороховых газов, МПа 90/105
Дульное сужение, упор, мм С 0,0
IC 0,25
M 0,5
IM 0,75
Ф 1,0
XF
Дульное сужение для стальной дроби С Расширение 0. 2
IC Расширение 0,1
M 0,2
IM 0,3
Ф 0,4
XF 0,52
Материал стыка и цевья Армированный пластик
Масса пушки, кг A 3,5-3,6 кг

Масса оружия указана без патронов.

Проект
Винтовка

МР-155 состоит из нескольких основных модулей.

  • Ствол с газовой камерой — ствол выполнен из нержавеющей стали, канал и патронник хромированы. Запираемый ствол качающейся личинки: он находится в стопоре и входит в зацепление с хвостовиком ствола. Трубка магазина полая, это возвратная пружина. Кольцевой газовый поршень расположен вокруг трубки магазина под стволом. Пароавтомат регулируется, но необходимо произвести частичную разборку.На стволе и ствольной коробке есть заряд.

Затвор — продольно-скользящий, запирание происходит за счет выступов клина, входящего в паз в стволе сцепления. Подъемный клин в заднем положении с затвором.

  • Коробка перехватывает и подствольный магазин состоит из двух частей: верхняя из анодированного алюминия и низ из ударопрочного пластика. Магазин на 5 патронов, коробчатого типа. Рычаг разблокировки плоский, на верхней ручке. В магазине может быть установлен ограничитель.
  • Мобильная система представляет собой затворную раму, затвор с клином, рычаг перезарядки и поршень, регулирующий скорость отката движущихся частей. Регулятор скорости установлен на поршне и включает в себя клапанное кольцо, пружину и регулировочную гайку. Это устройство позволяет использовать боеприпасы с различными баллистическими характеристиками. Кроме того, с помощью контроллера можно компенсировать влияние температуры и влажности, сбросив избыточное давление пороховых газов в воздух.

Задержка затвора позволяет остановить все движущиеся части винтовки в заднем положении в момент, когда все патроны израсходованы.

  • Возвратная пружина находится в гильзе магазина, обеспечивает автоматическую перезарядку винтовки.
  • Ударно-спусковой механизм — размещен на основании, ударного типа. УСМ находится внутри корпуса коробки и представляет собой съемный модуль. Механизм снабжен неавтоматической кнопочной защитой, блокирующей спусковой крючок. Он расположен в задней части спусковой скобы.

На ружье с открытым прицелом: целик регулируемый по горизонтали, летать вертикально. Имеет 2 позиции для открытого прицела и диоптрии.Целик установлен в съемную ручку для переноски винтовки. Кроме того, имеется планка ткацкого станка: после снятия рукоятки на винтовку может устанавливаться оптический или рефлекторный прицел.

  • Приклад с пистолетной рукояткой изготовлен из ударопрочного пластика.
  • Цевьё вентилируемое, пластмассовое.

Ружье совместимо со всеми выпускаемыми чоками.

Комплектование и упаковка

Стандартные продукты включают:

  • коробка картонная;
  • 3 штуцер;
  • универсальный ключ;
  • паспорт МП-155К.

Гильзы для замены дульной части продаются отдельно. Конструкция МР-155 позволяет заменять ствол дополнительным без каких-либо предварительных манипуляций.

Принцип работы

МР-155 Относится к самозарядным винтовкам. Этот механизм основан на использовании давления, которое создается пороховыми газами. Канал соединен с газовой камерой вентиляционных каналов. Пороховые газы, проходя через них, оказывают достаточное давление на механизм перезарядки.Существующий регулятор скорости позволяет увеличивать или уменьшать давление газа.

Использовать регулятор рекомендуется только после отстрела примерно 50-100 патронов. Регулировочная гайка, расположенная на поршне, повернута против часовой стрелки на 1-2 оборота при нажатии фиксатора. Используйте универсальный ключ. При стрельбе тяжелыми пулями поверните винт по часовой стрелке.

Механизм действия можно описать следующей схемой:

  • при нажатии на спусковой крючок курок попадает в ударник и воздействует на удерживатель. Последние выпуски перехватывает, и патрон из магазина подается в лоток;
  • под действием пороховых газов поршень с затворной рамой движется назад, затворная рама воздействует на клин и производит отпирание ствола;
  • подвижная система в целом движется назад: при этом использованная гильза извлекается из патронника и извлекается из ложи. Курок взвился;
  • возвратная пружина заставляет подвижную систему двигаться вперед: лоток, картридж поднимается и картридж находится в патроннике;
  • , когда затвор возвращается в переднее положение, ствол фиксируется движением затвора, при этом передний поршень поднимается и клин входит в выемку муфты.Вы можете выполнить следующий снимок;
  • после того, как все патроны израсходованы, затвор останавливается в заднем положении из-за задержки обратного хода.

МР-155 К предназначен для стрельбы боеприпасами свинцовой и стальной дробью. Однако дульное сужение не такое универсальное: на вставках, предназначенных для стрельбы свинцовой дробью, имеется маркировка Lead, для стальной дроби — «Steel». Патроны можно заряжать самостоятельно, но при этом необходимо придерживаться рекомендаций производителя и не менять навеску пороха и массовую долю.

Предпочтение отдается боеприпасам с пластиковым патроном, патроны с металлической гильзой не рекомендуются.

Используйте пули диаметром на 0,2–0,3 мм меньше диаметра ствола или дульного сужения. Калибрные пули из твердых материалов — стали, латуни не применяем.

Разборка

Для ухода за винтовкой — чистка и смазка, достаточно частичной разборки механизма. Стоит обратить внимание на отдельные детали. Итак, при отрыве клина от затвора боковой паз клина освобождает шарик.Изделие маленькое и его легко потерять.

Разборку регулятора проводить крайне нежелательно: предварительный натяг пружины клапана производится с большим усилием, и воспроизвести это усилие в домашних условиях практически невозможно.

Частичная разборка включает следующие этапы:

  • Отвинтите заглушку цевья и снимите ее;
  • с рукояткой сдвинуть затвор на 10-20 мм назад и достать пистолет из коробки;
  • снять ручку перегрузки, приложив усилие перпендикулярно оси затвора;
  • последовательно снимаем поршень, затворную раму, затвор с клином, затем возвратную пружину и кольцевой амортизатор;
  • из коробки выбиваем 2 штифта, удерживающие спусковой механизм в сборе и снимаем последними.

В этом состоянии винтовка доступна для чистки и смазки.

  • При необходимости ремонта допускается полная разборка карабина, включающая описанные манипуляции, снятие приклада и разборку УСМ.
  • Дальнейшая разборка разрешена только в оружейном магазине. Сборку карабина производите в обратном порядке.
  • Для смазки используйте оружейное масло, щетку для чистки, стержень для чистки и чистый протирочный материал.Для удаления прочных свинцов допускается использование латунной сетки или кисти.

На хранении МР-155 в разобранном, разряженном виде. Боеприпасы следует хранить отдельно.

Тюнинг

Конструкция МР-155 дает некоторые возможности для настройки. Выбор приспособлений зависит от назначения винтовки.

  • Замену коллиматора открытого прицела или оптическую настройку даже назвать сложно. И, кстати, вес пистолета в этом случае становится плюсом, поэтому ограничений по весу прицела нет.
  • Могут быть установлены и другие приспособления: газовый дульный компенсатор, например, или подствольный фонарь.
  • Одно из популярных решений — удлинение магазина. Для охоты, возможно, это улучшение чего-либо. А вот для спортивной стрельбы увеличенный размер МАГ на 10 патронов больше.

Цена и отзывы владельцев на ружье полуавтоматическое Байкал МП-155 К (МР-155К) указана ниже.

Цена

Стоимость МР-155 в магазинах Москвы достигает 30800 р.Используемое ружье можно найти за 20000 р.

.

Стоимость боеприпаса определяется его баллистическими характеристиками.

Отзывы

Практически все владельцы МР-155 отмечают высокую точность боя и вне зависимости от того, как вы стреляете картечью или патронами. Большой плюс — ствол не перегревается даже при активной стрельбе: избыток пороховых газов выводится через выемки в цевье.

  • Цевье удобное по охвату.Однако его материал — пластик, немного неудобный: выскальзывает из запотевших ладоней.
  • Что является явным минусом — это острый ободок ствольной коробки над спусковым крючком: быстро натирает ее пальцем.

МР-155, ружье, ружье — Охота Рыбалка

Гладкоствольное полуавтоматическое ружье МР-155 (не путать с МР 155 К) выпускается на Ижевском механическом заводе последние семь лет (также производит Артемис, Север, Экспресс, МП-18ЕМ-М, МР-27, МР-43 КН и др.).

Является результатом модернизации популярной модели MP-153, которая улучшила эргономику оружия, повысила его надежность и функциональность. О цене, характеристиках, отзывах владельцев об охотничьем ружье МР-155 и пойдет речь в этой статье.

Описание ружья МР-155

Гладкоствольное полуавтоматическое оружие с газовым инерционным двигателем, расположенным на подствольном трубчатом магазине, классической конструкции, используемой большинством оружейных компаний мира при производстве охотничьих полуавтоматов.

Преимущества и недостатки
  • Оружие надежное и неприхотливое в эксплуатации, безразлично к типу применяемых боеприпасов.
  • Модернизированный газовый двигатель, позволяющий более точно настраивать использование боеприпасов с разными партиями пороха.
  • Пистолет может стрелять как свинцовой, так и стальной дробью. Есть возможность установки сменного дульного сужения.
  • Пистолет
  • с патронником длиной 76 и 89 мм, что позволяет использовать боеприпасы с гильзами любых размеров.Производитель предлагает четыре варианта длины ствола.
  • К сожалению, набор калибров ограничен 12-м и 20-м. Шестнадцатое российское оружие в последнее время трудно игнорировать, хотя оно признано большинством охотников универсальным.
  • Защита кнопок и задержка ворот становятся длиннее, что увеличивает удобство использования. Появился механизм перехвата патронов в магазине, что позволило быстро перезаряжать боеприпасы другого типа.
  • Ствольная коробка укороченная из алюминиевого сплава, что позволило снизить вес оружия.
  • Предусмотрена возможность установки оптических прицелов — на верхней стороне ствольной коробки выполнены два параллельных подреза шириной 11 мм, образующих планку типа «ласточкин хвост».
  • Возможна установка магазина расширения.
  • Fly изготовлен из волоконно-оптических прядей красного цвета, что увеличивает удобство прицеливания.
  • Основание спускового механизма и предохранительная скоба из ударопрочного полиамида. Использование его в конструкции армейского АК — маленькое утешение для поклонников оружейной классики.К тому же клипса довольно угловатая, что не совсем эстетично.
  • Дизайнеры сделали коробку более изящной, сделав полипепестную ручку более плоской и менее выступающей. Наконец доработано цевье, которое в модели MP-153 больше походило на буханку. К сожалению, без косяков на данный момент не обошлось. Почему конструкторы сделали именно такую ​​настройку ствольной коробки, непонятно. Такие товарищи по углам могут сыграть злую шутку на охоте, поймав в нечетный час за ветками или чем-то еще.
  • Поставляется с набором проставок для изменения угла наклона приклада к ствольной коробке.
  • Изменена конструкция амортизатора отдачи, теперь гашение отдачи стало более эффективным.

Сменные дульные сужения кладут в комплект без дополнительной упаковки, что портит на них мелкую резьбу.

Ружье стало намного легче, приблизившись по этому показателю к лучшим зарубежным образцам.

Фото ружья МР-155

Назначение

В большей степени МР-155 — это оружие для охоты на дичь.Патрон с пулей может извлекаться и среднего размера с кабана или лося. Хорошие баллистические качества позволяют использовать его в спорте.

Сорта
Ружье

выпускается в калибрах 12 и 20 м. Кровать сделана из ореха, бука или ударопрочного пластика.

  • Ружья 12-го калибра могут иметь складной приклад или прилагаемую пистолетную рукоятку.
  • Есть вариант ружья, полностью укомплектованный винтовкой и летным.
  • Не все модели оснащены механизмом перехвата пуль.
  • Есть модели с левым расположением рукоятки затвора.
Технические характеристики
Калибр 12 калибр 20
Тип Винтовка самозарядная с газовым двигателем
Ствол Гладкая, с хромированным каналом и камерой
Установка ограничений замены Предоставляется
Длина болта (мм) 76, 89 76
Диаметр ствола у казённика (мм) 18,4 15,7
Длина ствола (мм) 610, 660, 710, 750 610, 660, 710
Вместимость 4 с патронником 76

3 с камерой 89

4
Увеличить емкость магазина 9 камер 76

К 8 с камерой 89

Масса ружья со стволом 710 (кг) 3,1 2,8
Дизайн

Самозарядное гладкоствольное оружие с газовым двигателем.

  • Ствол холоднокованый с хромированным каналом и патронником. На дульном срезе устроена резьба для установки изменяемых дульных сокращений.
  • Газовый двигатель расположен на подствольном трубчатом магазине. Регулируется с помощью подпружиненного поршня клапана. Давление, при котором пороховые газы стравливаются через полость цевья, изменяется за счет увеличения или уменьшения натяжения поршневой пружины.
  • Магазин трубчатый, есть возможность его удлинения.
  • Ствольная коробка из алюминиевого сплава, окошко гильз выбрасывателя правое или левое (левое). Окно бункерного цеха расположено в нижней части. Сверху выполнены две выемки, расстояние между которыми 11 мм, они образуют крепежную планку типа «ласточкин хвост» для установки оптических прицелов.
  • Зуб подвески затвора, входящий в зацепление с хвостовиком ствола при запирании. Зеркало личинки без краев, два зубца выбрасывателя.
  • Возвратная пружина устанавливается вместе с газовым двигателем, поэтому есть возможность снятия, замены или регулировки положения приклада.
  • Ударно-спусковой механизм с удерживаемым рычагом при отстреле последней пули. Кнопка рычага расположена перед спусковой скобой, между ней и бункером магазина.
  • В магазине есть механизм перехвата патронов. Рычаг тормоза расположен с левой стороны ствольной коробки. Если он будет лежать, пистолет будет задерживать затвор после каждого выстрела.
  • Кнопка предохранителя расположена в задних ветвях спусковой скобы, имеет треугольную форму. Чтобы привести оружие в боевое положение, следует щелкнуть справа налево, в результате появится красная метка в виде кольца. Предохранитель блокирует только спусковой крючок, курок остается взведенным.
  • Прицельные приспособления — вентилируемая планка и мушка с красными оптоволоконными нитями. Дополнительно устанавливаются винтовочный целик и мушка.
  • Кровать Polupoltina, с мягким захватом и прямым гребнем.
Комплектование и упаковка

Пистолет поставляется в картонной коробке с дробовиком. При желании может быть добавлен еще один ресивер.

Поставляется с комплектом сменных дульных сужений — цилиндр, чок, полочак, а также ключ для их установки, который служит для регулировки предварительного натяга пружины газового поршня. Есть регулировочные шайбы для изменения угла наклона приклада. Прилагаю инструкцию и паспорт.

Принцип работы

Пушка работает по принципу газового двигателя: при стрельбе из ствола отбирается часть пороховых газов, энергия которых используется для перемещения затвора и перезарядки. Перед заправкой магазина оружие ставится на предохранитель.

Патроны штабелируются через окно загрузки бункера, преодолевая сопротивление пружинного питателя, и фиксируются в магазине. Если вы хотите отправить дополнительный патрон в патронник, включенный механизм перехватывает патроны, который сдвигает рычаг с левой стороны ствольной коробки назад. Сдвинуть затворную раму и поставить на отсрочку. Положите боеприпасы на питатель элеватора. Переместите рычаг блокировки, но не до конца, а только странов его.Рамка затвора вернется в исходное положение и запретит канал ствола.

Если у вас включен механизм перехватывает патронов, то ружье будет вести одиночные выстрелы.

Для изменения натяжения пружины поршневого газового двигателя используется торцевой ключ сменного дульного сужения, имеющий дугообразную форму с зубом на конце. Он входит в прямоугольный вырез в гайке поршня. Для облегчения и понимания процесса весной риски обозначены цветом.

Разборка
  1. Несколько раз разрядить оружие, повернув затворную раму и удерживая ее в боевом положении.
  2. Снимите гайку в передней части магазина.
  3. Снять цевье.
  4. Вывести из ствола ответные части к ствольной коробке, сдвинув его дульное сечение по оси магазина.
  5. Нажмите на рычаг снятия с затворной задержки, удерживая лопасть за ручку от слишком большого возврата.
  6. Возьмитесь за поршень газового двигателя, прижмите прикладом к столу, чтобы сдвинуть болт на несколько дюймов назад.
  7. Выверните болт ручки.
  8. Постепенно отпустите поршень газового двигателя, позволяя возвратной пружине выпрямиться.
  9. Снять с магазина газовый поршень в сборе с рамой затвора и бойком.
  10. Снять магазин возвратной пружины.
  11. Отделив рамку клапана от поршня, снимите с него личинку.
  12. Выбить шпильку спускового крючка, вынуть его из ствольной коробки.
Тюнинг

С помощью регулировочных шайб можно изменить положение приклада относительно ствольной коробки или полностью изменить приклад, заменив рукоять пистолета.

Цена

Пистолет стоит от 23 до 28 тысяч рублей.

Отзывы

Ружье достаточно надежное и имеет хороший бой. Воздействие незначительное. Пользователи недовольны низким качеством сборки, изредка попадаются кривые стволы. Рукоятка болта держится неплотно, поэтому лучше запастись запасным. Больше похоже на пули, свернутые звездочкой.

155-мм Снаряды

155-мм снаряды

ФАС | Военные | DOD 101 | Системы | Land Warfare |||| Индекс | Поиск | Присоединяйтесь к ФАС



155-мм снаряды

Снаряды диаметром 155 мм. широкий спектр возможностей использования поля боя.

разрывных 155-мм снарядов
  • M104 — Подает пузырчатый газ H или HD [не в активной эксплуатации, планируется уничтожить].
  • M107 — Стандартный армейский фугасный снаряд, используемый в основном для осколочных и взрывных эффектов.
  • M110A1 / A2 — Подает пузырчатый газ H или HD [не в строю, подлежит уничтожению].
  • M116A1 / B1 — Создает белый химический дым для экранирования, определения пятен и сигнализация.
  • M121 / A1 — нервно-паралитический газ GB или VX [не используется, подлежит уничтожению]
  • M122 — нервно-паралитический газ [не в активной эксплуатации, планируется уничтожить]
  • M549A1 RAP — Состоит из двух компонентов, фугасной боевой части и ракетный двигатель; ракетный двигатель воспламеняется после выстрела из пушки и увеличивает дальность поражения пушки.
  • M687 — Двоичный нервно-паралитический газ GB [не в активной эксплуатации]
  • M795 — Осколочно-фугасный снаряд, предназначенный для замены складированного M107 и предназначенный для стрельбы с использованием метательной зоны верхней зоны.
  • M825 WP белый фосфорный дым
    Груз с 155-мм снарядами
    DPICM
  • M231 MACS
  • M232 MACS
  • M449A1 — Доставляет противопехотные суббоеприпасы для поражения живой силы противника на открытых или непокрытых территориях.
  • M483A1 FASCAM — Используется для доставки груза из 88 гранат M46 для поражения. броня и личный состав мишени.
  • M485A1 / A2 — Распределяет освещение груза для обеспечения без посторонней помощи в ночное время зрение.
  • M692 ADAM — Доставляет противопехотные мины.
  • M718A1 RAAM — Доставляет противотанковые мины, чтобы запретить / задержать доступ к конкретный район.
  • M731 ADAM — Доставляет противопехотные мины.
  • M741A1 RAAM — Доставляет противотанковые мины, чтобы запретить / задержать доступ к конкретный район.
  • M825A1 — Самая улучшенная версия дыма белого фосфора для затемнения видение для прикрытия маневрирующих сил.
  • M864 DPICM — Аналогичен M483A1 с добавлением базовой горелки сборка для уменьшения сопротивления и увеличения дальности.
  • XM867 — Экспериментальный снаряд, использующий электронное радио. глушилки.
155-мм умные / управляемые снаряды
  • M712 Медная головка
  • XM898 SADARM — Экспериментальный снаряд с грузом из двух суббоеприпасов. способен поражать тяжелобронированную технику. Каждый суббоеприпас содержит датчики обнаружения цели, средства стабилизации и управления скорость снижения и боевая часть, способная поражать броню.
  • XM982 — Аналог M483A1 с добавлением ракетного двигателя для дальнейшего увеличения эффективного диапазона и с опциями для увеличения доставки точность.

Боеприпасы раздельного заряжания используются в 155-мм гаубицах. Боеприпас раздельного заряжания состоит из четырех отдельных компонентов: капсюля, метательного заряда, снаряда и взрывателя. Четыре компонента выпускаются отдельно. При подготовке к стрельбе снаряд и метательный заряд загружаются в гаубицу за две отдельные операции.Боеприпасы раздельной загрузки пороха выпускаются отдельной единицей выдачи в герметичных канистрах для защиты пороха. Количество пороха, которое должно быть выпущено артиллерийскими боеприпасами, варьируется в зависимости от количества приращений пороха. Выбранный заряд зависит от дальности до цели и тактической ситуации.

  • Зеленый мешок, M3A1, метательный заряд предназначен для стрельбы зарядами с 1 по 5. Метательный порох скреплен четырьмя тканевыми ремнями, пришитыми к основанию и завязанными вручную поверх приращения 5.Пусковая площадка воспламенителя (3,5 унции CBI) расположена на основании. Все топливо M3A1 содержит примерно 5,5 фунтов одного перфорированного нейтрального горючего пороха. Перед зарядами 1 (подушечка 2 унции), 4 и 5 (подушечка 1 унция), 4 и 5 (подушечка на 1 унцию) пришиты пламегасители, содержащие сульфат или нитрат калия. Объясните, что каждое приращение различается по размеру, а также объясните назначение и функцию флэш-редукторов. Редукторы пламени ограничивают заднюю часть затвора, дульную вспышку и избыточное давление взрыва.
  • Мешок белый, метательное вещество M4A2 предназначено для зарядов с 3 по 7.Их базовая конфигурация такая же, как у ракетного топлива GB. M4A2 содержит приблизительно 13 фунтов. многоперфорированного (прогрессивного горения) метательного взрывчатого вещества. Подушку для понижения пламени, содержащую одну унцию нитрата калия или сульфата калия, пришивают к базовому приращению.
  • Charge 8WB, M119 — Этот одинарный, многоперфорированный, белый мешок-заряд с перфорированной трубкой сердечника воспламенителя, проходящей через центр метательного заряда, с пламегасителем, пришитым к переднему концу. Его можно использовать только в длинноствольных 155-мм гаубицах (серии M19 и M198).ХРАНИТЕ ГОРИЗОНТАЛЬНО благодаря центральной перфорированной трубке сердечника воспламенителя. Не может стрелять реактивными снарядами с использованием M119 из-за конструкции пламегасителя.
  • Charge 8WB, M119A1, точно такая же, как и M119, за исключением пончика, пришитого к переднему концу. Такая конструкция пламегасителя исключает воспламенение ракетного двигателя при РАП.
  • Заряд 7RB, M119A2, представляет собой единичный 7-зарядный пакет красного цвета для стрельбы из 155-мм гаубиц с пушечными стволами M185 и M199.Передний конец заряда имеет подкладку из свинцовой фольги весом 3 унции и четыре кармана, пришитых продольно по окружности. Каждый из четырех карманов содержит 4 унции сульфата калия, который действует как понизитель вспышки. Заряд 7RB может использоваться взаимозаменяемо с зарядом 8WB с незначительной разницей в начальной скорости пули. M119A2 был создан в соответствии с существующими таблицами стрельбы НАТО.
  • Метательное вещество M203 представляет собой зональный заряд 8S, предназначенный для обеспечения повышенной дальности действия гаубиц M198, M19A5 / A6. Метательный заряд M203 представляет собой однократный красный пакетный заряд с центральным сердечником воспламенителя, простирающимся по всей его длине, и пончикообразным пламегасителем на переднем конце заряда.M203 используется только с RAP M549A1 (заряженный TNT), M825 FELT WEDGE и базовыми снарядами M864.
  • Горючее M203A1 Также одноразовый базовый воспламеняющийся заряд. Внешний кожух — твердый горючий материал. У основания пороха все еще есть прокладка воспламенителя, и она содержит 0,7 унции черного пороха и 1 унцию CBI. Пропеллент не состоит из гранул; он состоит из 28 фунтов щелевого метательного взрывчатого вещества. Заряд M203A1 стреляет только снарядами M549A1 (в тротиловом заряде), RAP, фетровым клином M825 и снарядами M864 в гаубицах M198 и M109A5 / 6.Причины создания метательного заряда М203А1: 1) более холодное горение, меньше вспышек, взрыва и износа трубки. 2) Форма корпуса более прочная, что снижает повреждение сердечника воспламенителя. 3) Для автоматических загрузочных систем это позволяет избежать механических проблем.

Модульная система артиллерийских зарядов, заменяющая 155-мм метательные заряды, предлагает: упрощенная логистика по сравнению с традиционными мешковыми топливными системами.


Источники и ресурсы



FAS | Военные | DOD 101 | Системы | Land Warfare |||| Индекс | Поиск | Присоединяйтесь к ФАС
http: // www.fas.org/man/dod-101/sys/land/155.htm
Поддерживается Робертом Шерманом
Первоначально создано Джоном Пайком
Обновлено 6 февраля 2000 г. 14:54:32
Правила

, определяющие определенное огнестрельное и другое оружие, компоненты и части оружия, аксессуары, патронные магазины, боеприпасы и снаряды как запрещенные или ограниченные (SOR / 98-462)

87 Огнестрельное оружие конструкции, широко известной как M16, Винтовки AR-10 и AR-15 и карабин M4, а также любые их варианты или модифицированные версии, кроме упомянутых в пунктах 47, 49 или 50 настоящей Части, включая

  • (a) 2 Vets Arms 2VA -10;

  • (б) 2 Ветс Армс 2ВА-15;

  • (c) Системы точности A-15 Custom Edition LR Tech Tactical;

  • (d) Адамс Армс AA15;

  • (e) Адамс Армс AASF-308;

  • (f) Адамс Армс мультикал;

  • (г) ADC ADC234;

  • (ч) ADC ADC253;

  • (i) Adcor Defense A556 Elite GI;

  • (j) Adcor Defense ADC15;

  • (k) Adcor Defense B. УХО.;

  • (л) Adcor Defense Elite;

  • (м) Addax Tactical ADDAX-ZK;

  • (n) Addax Tactical AT-15;

  • (о) AdeQ Firearms L-Tac;

  • (p) AdeQ Firearms Paladin;

  • (q) AdeQ Firearms Venator;

  • (r) Advanced Armament Corporation MPW;

  • (s) Advanced Armaments Incorporated M15;

  • (т) Aero Precision A15;

  • (u) Aero Precision AP15;

  • (v) пистолет Aero Precision G15 Ghost Gun;

  • (w) Aero Precision h25;

  • (x) Карабин Aero Precision M4;

  • (у) Aero Precision M4E1;

  • (z) Aero Precision M5;

  • (г.001) Aero Precision M16A4;

  • (z.002) Пистолет Aero Precision;

  • (z.003) Aero Precision P-15 PEW;

  • (z.004) Aero Precision STS15;

  • (z.005) Aero Precision X15;

  • (z. 006) Airtronic DMR;

  • (z.007) Alamo Tactical AT-15;

  • (z.008) Тактическая винтовка Alberta AT15;

  • (z.009) Александр Армс AAR15;

  • (г.01) Александр Армс AAR15 Беовульф;

  • (z.011) Александр Армс AAR15 Beowulf Overwatch;

  • (z.012) Александр Arms AAR15 Genghis;

  • (z.013) Александр Армс AAR15 Grendel;

  • (z.014) Александр Армс AAR15 Grendel Overwatch;

  • (z.015) Александр Армс AAR17;

  • (z.016) Alien Armory UFO-10;

  • (z.017) Засадное огнестрельное оружие А11;

  • (г.018) Ameetec Arms AM-15 General;

  • (z.019) Ameetec Arms AM-15 Modular;

  • (z.02) Ameetec Arms AM-15 M4 Tactical Master;

  • (z.021) Ameetec Arms AM-15 Standard Tactical;

  • (z.022) Ameetec Arms AM-15 Standard Varmint;

  • (z.023) Ameetec Arms AM-15 Tactical Predator;

  • (z. 024) Ameetec Arms AM-15 Varmint Master;

  • (z.025) Ameetec Arms AM-15 9MM;

  • (г.026) Ameetec Arms WM-15;

  • (z.027) Америка помнит памятный знак Colt AR15A2 Match HBar Vietnam;

  • (z.028) Американское оборонное производство UICH;

  • (z.029) Американское оборонное производство UIC 10A;

  • (z.03) Американский исторический фонд Colt AR15A2 Sporter Match HBar Vietnam Tribute Special Edition;

  • (z.031) Американский исторический фонд Colt AR15A2 Sporter Target Operation Desert Storm памятный;

  • (г.032) American Precision Arms A15;

  • (z.033) American Spirit Arms ASA15;

  • (z.034) Пистолет American Spirit Arms ASA15;

  • (z.035) American Spirit Arms ASA308;

  • (z.036) Канадский карабин American Spirit Arms;

  • (z.037) American Tactical Imports AT-15;

  • (z.038) Американский тактический импорт ATI-15;

  • (z. 039) Американский тактический импорт MilSport;

  • (г.04) Американский тактический импорт MilSport Canadian;

  • (z.041) American Tactical Imports Omni;

  • (z.042) American Tactical Imports Omni Hybrid;

  • (z.043) Американский тактический импортный универсальный гибридный пистолет;

  • (z.044) Американский тактический импорт T14;

  • (z.045) Anderson Manufacturing AM-10;

  • (z.046) Anderson Manufacturing AM-15;

  • (z.047) Angstadt Arms JACK9;

  • (г.048) Наковальни AA15;

  • (z.049) Зона 53 Эль-Капитан;

  • (z.05) Area 53 El Jefe;

  • (z.051) Ares Defense Systems Ares-15;

  • (z.052) Ares Defense Systems Ares-15 MCR;

  • (z.053) Субкарабин Ares Defense Systems Ares-15 MCR;

  • (z.054) Ares Defense Systems SCR;

  • (z.055) AR Five Seven AR15;

  • (z. 056) AR Five Seven AR57 LEM;

  • (г.057) AR Five Seven AR57A1 PDW;

  • (z.058) Армалит АР-10А;

  • (z.059) Армалит АР-10А2;

  • (z.06) Армалит АР-10А4;

  • (z.061) Армалит АР-10Б;

  • (z.062) Армалит АР-10 КЛМ;

  • (z.063) Armalite AR-10 Magnum;

  • (z.064) Армалит АР-10НМ;

  • (z.065) Армалит АР-10Т;

  • (z.066) Armalite AR-102 Sporter;

  • (г.067) Армалит M4C Карабин;

  • (z.068) Армалит M15;

  • (z.069) Армалит M15A2;

  • (z.07) Армалит M15A4;

  • (z.071) Армалит M15A4 T;

  • (z.072) Пистолет Armalite M15;

  • (z.073) Armalite SPR Mod 1;

  • (z.074) Armalite SPR Mod 2;

  • (z.075) Armalite SPR Mod 2A;

  • (z.076) Пистолет Armalite AR-10;

  • (г.077) Armi Jager AP15;

  • (z. 078) Armi Jager AP74;

  • (z.079) Armitage International BR-15-A6S;

  • (z.08) Армскорп АС-15;

  • (z.081) Arms East N8S;

  • (z.082) Armtech X;

  • (z.083) Ascend Armory A15;

  • (z.084) AR15 Болтун CB-15;

  • (z.085) AR15.Com ARFCOM;

  • (z.086) AR15.Com AR15.Com;

  • (z.087) AXTS AX556;

  • (z.088) Badrock Tactical BR10;

  • (z.089) Badrock Tactical BR15;

  • (z.09) Bartlett Enterprises 1202009;

  • (z.091) Barrett Firearms M468;

  • (z.092) Barrett Firearms REC7;

  • (z.093) Barrett Firearms REC10;

  • (z.094) Разработка боевого оружия BAD-PDW;

  • (г.095) Разработка боевого оружия БАД-15;

  • (z.096) Разработка боевого оружия BAD556-LW;

  • (z.097) Боевая стрелковая рота BR15;

  • (z. 098) Боевая стрелковая рота BR16;

  • (z.099) Боевая стрелковая рота BR308;

  • (z.1) BCI Defense SQS-15;

  • (z.101) BCM Rifle Company BCM4;

  • (z.102) BCM Rifle Company M4A1;

  • (z.103) Бобовое огнестрельное оружие BFC-15A;

  • (г.104) Bear Creek Arsenal BCA15;

  • (z.105) Black Creek Labs BCL15;

  • (z.106) Black Creek Labs BCL102;

  • (z.107) Black Creek Labs BCL102B;

  • (z.108) Черный Рассвет БДР-15;

  • (z.109) Black Forge BF15;

  • (z.11) Blackheart International BHI-15;

  • (z.111) Black Leaf Industries BL10;

  • (z.112) Прототип BL10B Black Leaf Industries;

  • (г.113) Black Leaf Industries BL15;

  • (z.114) Black Rain Ordnance Fallout 10;

  • (z.115) Black Rain Ordnance Fallout 15;

  • (z.116) боеприпасы Black Rain SPEC15;

  • (z. 117) Black Rifle Company BRC15B;

  • (z.118) Blackwater BW-15;

  • (z.119) Оружейная черная оружейная BWA-15;

  • (z.12) Blue Line BL-15LE1;

  • (z.121) Boberg CDH-15;

  • (г.122) Bohica M16SA;

  • (z.123) BPM BP15;

  • (z.124) BPM CQB-10;

  • (z.125) БПМ LR-10;

  • (z.126) Breda B4;

  • (z.127) БРН-16А1 Браунелла;

  • (z.128) БРН-601 Браунелла;

  • (z.129) XBRN16E1 Браунелла;

  • (z.13) Bushmaster Carbon 15;

  • (z.131) Bushmaster XM15E2S;

  • (г.132) Bushmaster XM15E2S Правоохранительные органы;

  • (z.133) Bushmaster XM15E2S M4;

  • (z.134) Bushmaster XM15E2S M4GP;

  • (z.135) Bushmaster XM15E2S Predator;

  • (z.136) Bushmaster XM15E2S Varminter;

  • (z.137) Bushmaster XM15E2S 450 Bushmaster;

  • (z.138) спортивная винтовка Bushmaster XM15E2S DCM;

  • (z.139) Bushmaster Bushmaster 308;

  • (г.14) Бушмастер БАР-10;

  • (z.141) Bushmaster XM15E2S V Match;

  • (z.142) Bushmaster BR-308;

  • (z.143) C3 Defense C3-15;

  • (z.144) Cadex AR15 Karpat SPVM;

  • (z.145) Cadex CDX-10;

  • (z.146) Cadex CDX-15;

  • (z.147) Calguns AR15;

  • (z.148) Canstar Arms AR 338 Lapua;

  • (z.149) Кавалерийское вооружение CAV-15;

  • (г.15) Кавалерийское вооружение CAV-15 MARK 2;

  • (z.151) Cavalry Arms CAV-15 Стрелок;

  • (z.152) Centurion Arms C4;

  • (z.153) Centurion Tactical CT-15;

  • (z.154) Century Arms C15A1 Sporter;

  • (z.155) Century Arms C15 Sporter;

  • (z.156) Centurion International Arms Centurion 15 Sporter;

  • (z.157) Charles Daly Defense CDD-15;

  • (г.158) Chiappa Firearms M Four-22;

  • (z.159) Пистолет Chiappa Firearms M Four-22;

  • (z.16) Chirstensen Arms Carbon CA-10 DMR;

  • (z.161) Christensen Arms Carbon CA-10 G2;

  • (z.162) Christensen Arms Carbon CA-10 Recon;

  • (z.163) Christensen Arms Carbon CA-15;

  • (z.164) Christensen Arms Carbon CA-15 Predator;

  • (z.165) Christensen Arms Carbon CA-15 Recon;

  • (г.166) Christensen Arms Carbon CA TAC 10;

  • (z.167) Clark Custom Guns Gator;

  • (z.168) CLE MR15;

  • (z.169) CMMG Mod4SA;

  • (z.17) CMMG MK3;

  • (z.171) КИМГ МК-4;

  • (z.172) КИМГ МК-5;

  • (z.173) КИМГ МК-8;

  • (z.174) КИМГ МК-9;

  • (z.175) КИМГ МКГ-45;

  • (z.176) CMMG MKW-15;

  • (г.177) CMT LT-15;

  • (z.178) Cobalt Kinetics BAMF;

  • (z.179) Cobalt Kinetics CARS;

  • (z.18) Cobb MCR;

  • (z.181) Cobb MCR 30-06 SPRG Памятная годовщина 100-летия;

  • (z.182) Colt AR15A2 Sporter 2;

  • (z.183) Colt AR15;

  • (z.184) Colt AR15 SP1;

  • (z.185) Colt AR15A2 Match Target Lightweight;

  • (г.186) Кольт AR15A2 Правительство;

  • (z.187) Colt AR15A2 Sporter Delta HBar;

  • (z.188) правительственный карабин Colt AR15A2;

  • (z.189) Colt AR15A2 Sporter Competition HBar;

  • (z.19) Colt AR15A2 Match Target HBar;

  • (z.191) Colt AR15A2;

  • (z.192) Colt AR15A2 Sporter HBar;

  • (z.193) Colt AR15 Match HBar;

  • (z.194) Colt AR15 Sporter;

  • (г.195) Мишень для карабина Colt M4;

  • (z.196) Модель Colt AR15A2 Match Target Target;

  • (z.197) Тактический карабин Colt AR15A3;

  • (z.198) Colt AR15A3 Match Target Competition HBar;

  • (z.199) Colt AR15A2 Sporter Match Target Competition HBar 2;

  • (z.2) Colt AR15 Sporter Lightweight;

  • (z.201) Colt AR15A2 Sporter Match Target Lightweight;

  • (г.202) Colt AR15A2 Sporter Target;

  • (z.203) Colt AR15A2 Government Target;

  • (z.204) Colt AR15A2 Sporter Match Target HBar;

  • (z.205) Colt AR15A2 Sporter Match Delta HBar;

  • (z.206) Colt AR15A2 Match Delta HBar;

  • (z.207) Colt AR15A2 Sporter Match Target Competition HBar;

  • (z.208) Выбран диапазон Colt AR15A2 Sporter Competition HBar;

  • (г.209) Colt AR15A2 Match Target Competition HBar 2;

  • (z.21) Colt CAR15A3 HBar Elite;

  • (z.211) Карабин Colt AR15 9MM;

  • (z.212) Карабин Colt AR15A2;

  • (z.213) Colt AR15A2 Sporter Match HBar;

  • (z.214) Карабин для правоохранительных органов Colt Colts;

  • (z.215) Colt C7CT;

  • (z.216) Colt C7A1;

  • (z.217) Colt C7A2;

  • (г.218) Кольт ИУР;

  • (z.219) Colt M4 Carbine Sporter;

  • (z.22) Модульный карабин Colt;

  • (z.221) Карабин Colt M4A1;

  • (z.222) Карабин Colt M4;

  • (z.223) Colt SA15.7;

  • (z.224) Colt SA20;

  • (z.225) Colt AR-15A4;

  • (z.226) Легкий карабин Colt AR15A4 LE;

  • (z.227) Colt AR15 M16A1;

  • (г.228) Целевая модель Colt AR15;

  • (z.229) Colt M4LE;

  • (z.23) Colt M4 Light Carbine;

  • (z.231) винтовка Colt M16;

  • (z.232) Colt M16 SPR;

  • (z.233) Colt M16A2;

  • (z.234) Карабин Colt AR15A2 Sporter;

  • (z.235) Карабин Colt M16A2;

  • (z.236) Colt SMG;

  • (z.237) Colt Competition CCR Competition;

  • (г.238) Colt Competition CSR Sporting;

  • (z.239) Combat Shooters BMF;

  • (z.24) Conquest Arms CA-15;

  • (z.241) Core Core-15;

  • (z.242) Станок поперечный UHP-15;

  • (z.243) Крестообразный станок UHP15A;

  • (z.244) Крестообразный станок UHP15H;

  • (z.245) Крестообразный станок UHP15-PDW;

  • (z.246) Крестовой станок UHP15SSA;

  • (г.247) Станок поперечный УХП-10;

  • (z.248) Dalphon BFD;

  • (z.249) Dane Armory DAR-15;

  • (z.25) Daniel Defense DD-15;

  • (z.251) Карабин M4 Daniel Defense;

  • (z.252) Daniel Defense DD MK762;

  • (z.253) Daniel Defense DDM4;

  • (z.254) Daniel Defense DD5;

  • (z.255) Карабиновый пистолет Daniel Defense M4;

  • (г.256) Dark Storm Industries DS-15;

  • (z.257) Defiance DMK22;

  • (z.258) Defiance Machine XG14;

  • (z.259) Delaware Machinery AR15;

  • (z.26) Delphi Tactical Delphi-15;

  • (z.261) Dennys Guns DG-AR16;

  • (z.262) винтовка Desert Ordnance XM4;

  • (z.263) Detroit Gun Works DGW15;

  • (z.264) Devil Dog Arms DDA-15B;

  • (г.265) Devil Dog Arms DDA-10B;

  • (z.266) Dez Arms DTA-10;

  • (z.267) Огнестрельное оружие Diamondback DB-10;

  • (z.268) Огнестрельное оружие Diamondback DB-15;

  • (z.269) Винтовка Diemaco C10;

  • (z.27) Diemaco Rifle Experimental 84;

  • (z.271) Тип Dlask Arms AR15;

  • (z.272) Dlask Arms DAR701;

  • (z.273) Dlask Arms DAR701 Канада 150 День рождения;

  • (г.274) Dlask Arms PAC-5;

  • (z.275) Dominion Arms DA556;

  • (z.276) Double Star Star-15;

  • (z.277) Карабин Double Star Star-15;

  • (z.278) винтовка Double Star-15 Super Match;

  • (z.279) Double Star-15 CritterSlayer;

  • (z.28) Экспедиционная винтовка Double Star Star-15;

  • (z.281) Диссипатор Double Star Star-15;

  • (г.282) Целевая винтовка Double Star Star-15;

  • (z.283) Double Star Star-15 Lightweight Tactical;

  • (z.284) Пистолет Double Star Star-15;

  • (z.285) Double Star Star-10B;

  • (z.286) Dow FAL-15;

  • (z.287) DPMS A-15;

  • (z.288) DPMS A-15 Panther Bull;

  • (z.289) DPMS A-15 Panther Bull Twenty-Four;

  • (z.29) DPMS A-15 Panther Bull Twenty-Four Special;

  • (г.291) DPMS A-15 Panther Bull Twenty-Four Super;

  • (z.292) ДПМС А-15 Пантера Бульдог;

  • (z.293) DPMS A-15 Panther Bull Sixteen;

  • (z.294) DPMS A-15 Panther Bull SST Sixteen;

  • (z.295) DPMS A-15 Panther Bull Classic;

  • (z.296) DPMS A-15 Panther Prairie;

  • (z.297) ДПМС А-15 Пантера Арктика;

  • (z.298) DPMS A-15 Panther Classic;

  • (г.299) ДПМС А-15 Пантера ДКМ;

  • (z.3) DPMS A-15 Panther Southpaw;

  • (z.301) DPMS A-15 Panther Classic Sixteen;

  • (z.302) DPMS A-15 Panther Kitty Kat;

  • (z.303) DPMS A-15 Panther Carbine;

  • (z.304) DPMS A-15 Panther Race Gun;

  • (z.305) DPMS A-15 Panther Tactical;

  • (z.306) DPMS A-15 Panther Classic Lo-Pro;

  • (г.307) ДПМС LR-308 Пантера;

  • (z.308) ДПМС А-15 Карабин «Пантера» М-4;

  • (z.309) DPMS A-15 Panther Lite;

  • (z.31) DPMS A-15 Panther Tuber;

  • (z.311) DPMS LR-300 Panther;

  • (z.312) DPMS A-15 Panther 20th Anniversary;

  • (z.313) DPMS LR-243 Panther;

  • (z.314) DPMS LR-260 Panther;

  • (z.315) DPMS LR-204 Panther;

  • (г.316) ДПМС LR-30S Пантера;

  • (z.317) DPMS A-15 Panther Pardus;

  • (z.318) DPMS LR-338 Panther;

  • (z.319) DPMS LR-6.5 Panther;

  • (z.32) DPMS A-15 Panther Sportical;

  • (z.321) DPMS A-15 Пантера Агентство;

  • (z.322) DPMS A-15 Panther CSAT;

  • (z.323) DPMS A-15 Panther LBR Carbine;

  • (z.324) DPMS A-15 Panther Hunter;

  • (г.325) ДПМС А-15 Пантера 300 Блэкаут;

  • (z.326) DPMS LR-G2 Panther;

  • (z.327) DPMS A-15 Panther VRS Single Shot;

  • (z.328) Насосная винтовка DPMS A-15 «Пантера»;

  • (z.329) ДПМС А-15 Пантера 22;

  • (z.33) DPMS A-15 Panther VAS Single Shot;

  • (z.331) ДПМС А-150 Пантера;

  • (z.332) DPMS G2;

  • (z.333) DRD Paratus;

  • (г.334) DRD M762;

  • (z.335) DRD CDR-15;

  • (z.336) DRD Kivaari;

  • (z.337) DRD D8;

  • (z.338) DSA Incorporated ZM4;

  • (z.339) DTI DTI-15;

  • (z.34) Dynamic Arms Research (DAR) DAR-10;

  • (z.341) Dynamic Arms Research (DAR) DAR-15;

  • (z.342) E3 Arms Омега-15;

  • (z.343) Eagle Arms Division of Armalite AR-10;

  • (г.344) Орлиный Оружейный Дивизион Армалит Орёл-15;

  • (z.345) Eagle Arms Division of Armalite M15;

  • (z.346) Eagle Arms Division of Armalite M15A2;

  • (z.347) Eagle Arms Division of Armalite M15A3;

  • (z.348) Eagle Arms Division of Armalite M15P;

  • (z.349) Eagle Arms Incorporated EA-15;

  • (z.35) EDs Tactical Armory 2A;

  • (z.351) Elite Machining GRX15;

  • (г.352) Эмтан ЭМ-15;

  • (z.353) Enfield Rifle Company MERC415;

  • (z.354) EP Armory Тип AR15 / M16;

  • (z.355) Essential Arms Company J15;

  • (z.356) Essential Arms Company J15F;

  • (z.357) Essential Arms Company J15-2;

  • (z.358) F&D Defense FD308;

  • (z.359) F-1 Огнестрельное оружие BDR-10 CA;

  • (z.36) F-1 Огнестрельное оружие BDR-10-3G CA;

  • (г.361) Ф-1 Огнестрельное оружие БДР-15 СА;

  • (z.362) F-1 Огнестрельное оружие BDR-15-3G CA;

  • (z.363) F-1 Огнестрельное оружие FDR-15 CA;

  • (z.364) F-1 Огнестрельное оружие УДР-15-3Г;

  • (z.365) Falkor Defense FD-15A;

  • (z.366) Faxon Firearms ARAK-21 XRS;

  • (z.367) Ferfrans SOACR;

  • (z.368) Fightlite Industries MCR;

  • (z.369) Прецизионное огнестрельное оружие Firebird FPX-15;

  • (г.37) ФМК АР-1 Патриот;

  • (z.371) FMK AR1 Extreme;

  • (z.372) FN FNX-01;

  • (z.373) FN FN15;

  • (z.374) Карабин FN FN15;

  • (z.375) Винтовка FN FN15;

  • (z.376) Fortis Manufacturing FM15;

  • (z.377) Франкфорд Арсенал XM-177E2;

  • (z.378) Franklin Armory F17-L;

  • (z.379) Franklin Armory F17-V4;

  • (г.38) Franklin Armory HSC-15;

  • (z.381) Franklin Armory Libertas;

  • (z.382) Fulton Armory FAR-15;

  • (z.383) Fulton Armory FAR-308;

  • (z.384) GA Precision GAP-10;

  • (z.385) GA Precision GAP-10 G2;

  • (z.386) Gilboa Shorty 7;

  • (z.387) Gilboa Commando 11.5;

  • (z.388) Gilboa SMG;

  • (г.389) Гильбоа М-43;

  • (z.39) Гильбоа Карабин 14,5;

  • (z.391) Гильбоа DMR;

  • (z.392) Гильбоа Змея;

  • (z.393) GPI Manufacturing SLR15;

  • (z.394) Гранд Армерия Камуна (GAC) GAC-15;

  • (z.395) Серый Ghost Precision GGP-SBL;

  • (z.396) Серый Призрак Precision GGP-S Grim;

  • (z.397) Серый Ghost Precision GGP-S Heavy;

  • (г.398) Серый призрак Precision GGP-SLF;

  • (z.399) Серый светильник Ghost Precision GGP-S;

  • (z.4) Серый призрак Precision Spectre Light;

  • (z.401) GT Virtual Concepts GT15;

  • (z.402) ГТО Core-15;

  • (z.403) GTO Hard Core 15;

  • (z.404) Gun Room Company Noreen Bad News;

  • (z.405) Gunwerks WY15;

  • (z.406) Haenel CR223;

  • (г.407) Haenel CR308;

  • (z.408) Hayes Custom Guns h25;

  • (z.409) Голова вниз HD-15;

  • (z.41) Heckler & Koch HK416D;

  • (z.411) Heckler & Koch HK417;

  • (z.412) Heckler & Koch HKM4C;

  • (z.413) Heckler & Koch MR;

  • (z.414) Heckler & Koch MR223;

  • (z.415) Heckler & Koch MR308;

  • (г.416) Heckler & Koch MR556A1;

  • (z.417) Heckler & Koch MR762A1;

  • (z.418) Hera Arms HLS;

  • (z.419) Hera Arms HCL;

  • (z.42) Hera Arms HCL9M;

  • (z.421) Hesse Arms HAR15A2;

  • (z.422) Hesse Arms HAR15A2 Bull Gun;

  • (z.423) Национальный матч Hesse Arms HAR15A2;

  • (z.424) Hesse Arms HAR15A2 Standard;

  • (г.425) Hesse Arms HAR25;

  • (z.426) Hesse Arms Omega Match;

  • (z.427) High Standard HSA-15;

  • (z.428) High Standard HSA-15 Crusader;

  • (z.429) High Standard HSA-15 Enforcer;

  • (z.43) High Standard HSA-15 Enforcer 300;

  • (z.431) Hogan Manufacturing H-308;

  • (z.432) Hogan Manufacturing h323;

  • (z.433) Hogan Manufacturing H-415;

  • (г.434) Hogan Manufacturing H-416;

  • (z.435) Holland Gunworks HGW15;

  • (z.436) Hughes Precision HR-15F;

  • (z.437) Huldra MARK 4;

  • (z.438) Imperial Defense Services M16A3;

  • (z.439) Interarms ISA-15;

  • (z.44) Inter Ordnance IO-G9;

  • (z.441) Intrepid Tactical Solutions RAS-12;

  • (z.442) Стрелковый завод Айрон-Сити IC-9;

  • (г.443) Стрелковый завод Айрон-Сити ИК-15;

  • (z.444) Iron Ridge Arms ИРА-10Д;

  • (z.445) Ирунгунская анархия;

  • (z.446) ISSC PAR223 Delta;

  • (z.447) Jager AP74;

  • (z.448) Jard J15;

  • (z.449) JC Weaponry JC Weaponry;

  • (z.45) JD Machine PR3;

  • (z.451) Джесси Джеймс Неограниченный карабин M4 Firearms;

  • (г.452) Joe Firearms JOE-15;

  • (z.453) JP Enterprises JP-15 Match;

  • (z.454) JP Enterprises JP-15;

  • (z.455) JP Enterprises JP-15 IPSC Ограниченный класс;

  • (z.456) JP Enterprises JP-15 NRA Match;

  • (z.457) JP Enterprises JP-15 Tactical / SOF;

  • (z.458) JP Enterprises AR-10;

  • (z.459) JP Enterprises Edge Grade 3;

  • (г.46) JP Enterprises CTR-02;

  • (z.461) JP Enterprises LRP-07;

  • (z.462) JP Enterprises SCR-11;

  • (z.463) JP Enterprises JPE-15;

  • (z.464) JP Enterprises МБРГ-13;

  • (z.465) JP Enterprises GMR15;

  • (z.466) Juggernaut Tactical JT-10;

  • (z.467) Juggernaut Tactical JT-15;

  • (z.468) Kaiser Defense Calguns.Net;

  • (г.469) Kaiser Defense KR5;

  • (z.47) Kaiser Military Technologies KR7;

  • (z.471) KE Arms KE-15;

  • (z.472) Kiss Tactical KISS-15;

  • (z.473) Kiss Tactical K-15SE;

  • (z.474) Knights Manufacturing Company SR-15;

  • (z.475) Kodiak Defense JTF2 Silver Edition;

  • (z.476) Kodiak Defense KD9;

  • (z.477) Kodiak Defense KD15;

  • (г.478) Кадьяк Дефенс Кадьяк-15;

  • (z.479) Kodiak Defense Kodiak-39;

  • (z.48) Lancer Systems LP L15;

  • (z.481) Lancer Systems LP L30;

  • (z.482) Lantac LA-N15;

  • (z.483) Lantac LA-R15;

  • (z.484) Lantac LA-SF15;

  • (z.485) Лантак МК-4;

  • (z.486) LAR Manufacturing Grizzly-15;

  • (г.487) LAR Производство AA15;

  • (z.488) LAR Manufacturing SK15;

  • (z.489) LaRue Tactical LT-15;

  • (z.49) LaRue Tactical LT-762;

  • (z.491) Lauer Custom Weaponry LCW15;

  • (z.492) Lead Star LSA9;

  • (z.493) LEI LM7;

  • (z.494) Винтовка Leitner-Wise LW15-7.82;

  • (z.495) Винтовка Leitner-Wise LW15-22;

  • (г.496) Винтовка Leitner-Wise LW15-499;

  • (z.497) Les Baer Custom Ultimate AR;

  • (z.498) Les Baer Custom Ultimate;

  • (z.499) Пользовательский матч Les Baer;

  • (z.5) Les Baer Custom Match AR;

  • (z.501) Les Baer Custom Thunder Ranch Special;

  • (z.502) Les Baer Custom Monolith SWAT;

  • (z.503) Les Baer Custom AR IPSC Action;

  • (г.504) Les Baer Custom AR Super Match;

  • (z.505) LMT Defender 2000;

  • (z.506) LMT L129A1;

  • (z.507) LMT LM308MWS;

  • (z.508) LMT MARS LS;

  • (z.509) Loki Weapon Systems LWSF;

  • (z.51) Lone Wolf R&D LWD-AR9G;

  • (z.511) Пистолет Lone Wolf R&D LWD-AR9G;

  • (z.512) LRB Arms M15SA;

  • (г.513) Luvo BL-15LE;

  • (z.514) Luvo BL-15LE1;

  • (z.515) Luvo LA-15;

  • (z.516) LWRC SABR;

  • (z.517) LWRC REPR;

  • (z.518) LWRC Six8;

  • (z.519) LWRC CSASS;

  • (z.52) LWRC REPR MARK 2;

  • (z.521) LWRC 224 Valkyrie;

  • (z.522) LWRC M6IC;

  • (z.523) LWRC M6 / M6A2;

  • (г.524) М2 М16С;

  • (z.525) M2 M16SP;

  • (z.526) M2 M16X;

  • (z.527) M2 M4N;

  • (z.528) M2 Patrol;

  • (z.529) M2 M16Z1;

  • (z.53) MAG Tactical Systems MG-G4;

  • (z.531) Magpul Armament MPLA;

  • (z.532) Manta Machining PA15;

  • (z.533) Manta Machining JH 308-F2;

  • (г.534) Matrix Aerospace МА-15;

  • (z.535) Matrix Aerospace M-762;

  • (z.536) Matrix Aerospace M762-D;

  • (z.537) Maxim Firearms B7075;

  • (z.538) McDuffee Arms MAR15;

  • (z.539) McDuffee Arms MLR308;

  • (z.54) McKay Enterprises RM16A2;

  • (z.541) Mega Arms MEGA MA-Ten;

  • (z.542) Mega Arms GTR-3H;

  • (г.543) Мега Механический цех МЕГА ММС;

  • (z.544) Mega Machine Shop MEGA Gator;

  • (z.545) Мега Механический цех МЕГА ГТР-3Н;

  • (z.546) Мега Механический цех МЕГА ГТР-3С;

  • (z.547) Мега Механический цех МЕГА ГТР-МА-Тен;

  • (z.548) Mega Machine Shop MEGA MG-XTR;

  • (z.549) MG Arms K-Yote;

  • (z.55) MG Arms Taranis Light;

  • (г.551) МГИ Марк 15;

  • (z.552) MGO Zombie;

  • (z.553) Midwest Industries MI-15F;

  • (z.554) Miller Precision Arms MPA300 Guardian;

  • (z.555) Прецизионное оружие Миллера MPA556;

  • (z.556) Miller Precision Arms MPA762;

  • (z.557) Miller Precision Arms MPAR10;

  • (z.558) Mil-Sport AR15;

  • (z.559) Пистолет Mil-Sport AR15;

  • (г.56) Mitchell Arms CAR15 / 22;

  • (z.561) Mitchell Arms M16 / 22;

  • (z.562) Mitchell Arms M16A1 / 22;

  • (z.563) Mitchell Arms M16A3 / 22;

  • (z.564) МКЭ КНТ-76;

  • (z.565) MMC Armory MA-15;

  • (з.566) МОЛОТ Вепрь-15;

  • (z.567) Moores Machine Company MMC M4;

  • (z.568) Mossberg MMR Tactical;

  • (г.569) Mossberg MMR Hunter;

  • (з.57) Мотюк Мануфактуринг МРК-15;

  • (z.571) MVB Industries MVB-15F;

  • (z.572) Nemesis Arms 11X10;

  • (z.573) NEMO Battle Light;

  • (z.574) NEMO Omen;

  • (z.575) NEMO Battle Light 1.0;

  • (z.576) New Frontier Armory C9;

  • (z.577) New Frontier Armory G-15;

  • (г.578) New Frontier Armory LW-15;

  • (z.579) Новое поколение Arms MFR;

  • (z.58) Оружие нового поколения MP168 SPC;

  • (z.581) Вооружение нового уровня NLX556;

  • (z.582) NoDak Spud NDS-16A1;

  • (z.583) NoDak Spud NDS-16A2;

  • (z.584) NoDak Spud NDS-601;

  • (z.585) NoDak Spud NDS-635;

  • (z.586) NoDak Spud NDS-XM16E1;

  • (г.587) Nord Arms NA-308;

  • (z.588) Скандинавские компоненты NC-PCC;

  • (z.589) Норин Огнестрельное оружие Норин Плохие новости;

  • (z.59) Noreen Firearms Noreen BN36;

  • (z.591) Noreen Firearms Noreen BN308;

  • (z.592) Norinco 311-3;

  • (z.593) Norinco Type CQ 311;

  • (z.594) Norinco Тип CQ 311-1;

  • (z.595) Полуавтоматическая винтовка Norinco Type CQ;

  • (г.596) Полуавтоматическая винтовка Norinco Type CQ-A;

  • (z.597) Полуавтоматическая винтовка Norinco Type CQ-A-1;

  • (z.598) North Eastern Arms NEA-15;

  • (z.599) Пистолет North Eastern Arms NEA-15;

  • (z.6) North Eastern Arms NEA-25;

  • (z.601) North Eastern Arms NEA102;

  • (z.602) Northtech Defense NT15S;

  • (z.603) Новеске N4;

  • (г.604) Новеске N6;

  • (z.605) Новеске Вармагеддон, АР;

  • (z.606) Oberland Arms OA10;

  • (z.607) Oberland Arms OA15;

  • (z.608) Olympic Arms PCR;

  • (z.609) Olympic Arms MFR;

  • (z.61) Olympic Arms K3B;

  • (z.611) Olympic Arms K40GL;

  • (z.612) Olympic Arms K9GL;

  • (z.613) Olympic Arms LTF;

  • (г.614) Плинкер Олимпик Армс Плюс;

  • (z.615) Olympic Arms UM1P Ultramatch;

  • (z.616) Olympic Arms UMAR;

  • (z.617) Olympic Arms MPR 308-15;

  • (z.618) Olympic Arms CAR15 AR;

  • (z.619) Olympic Arms CAR97;

  • (z.62) Olympic Arms UM1 Ultramatch;

  • (z.621) Olympic Arms ML1 Multimatch;

  • (z.622) Olympic Arms ML2 Multimatch;

  • (г.623) Олимпийское оружие K4B;

  • (z.624) Билль о правах Олимпийского оружия, посвященный двухсотлетнему юбилею;

  • (z.625) Olympic Arms SM1 Servicematch;

  • (z.626) Olympic Arms Титан;

  • (z.627) Плинкер Olympic Arms;

  • (z.628) Olympic Arms FAR-15;

  • (z.629) Olympic Arms K8;

  • (z.63) Olympic Arms MQ356;

  • (z.631) Памятный знак Olympic Arms Vietnam Limited Edition;

  • (г.632) Olympic Arms SM1P Servicematch;

  • (z.633) Olympic Arms K22 Матч с кольцевым воспламенением;

  • (z.634) Palmetto Armory Bh25A1;

  • (z.635) Государственная Оружейная палата Пальметто GX-9;

  • (z.636) Государственная Оружейная палата Пальметто ПА-10;

  • (z.637) Государственная Оружейная палата Пальметто PA-15;

  • (z.638) Palmetto State Armory PX9;

  • (z.639) Palmetto State Armory PX-10;

  • (г.64) Patriot Defense Arms PDA-15;

  • (z.641) Технические характеристики СОТ-15;

  • (z.642) Phase 5 Tactical P5T15;

  • (z.643) Phase 5 Tactical Atlas One;

  • (z.644) Огнестрельное оружие Plumcrazy C15;

  • (z.645) POF CMR;

  • (z.646) ПОФ П-15;

  • (z.647) POF P300;

  • (z.648) POF P308;

  • (z.649) POF P415;

  • (г.65) ПОФ П416;

  • (z.651) Полуавтоматическая винтовка Poly Technologies типа CQ-A;

  • (z.652) Прецизионное огнестрельное оружие PF15;

  • (z.653) Прецизионное огнестрельное оружие PF-X08;

  • (z.654) PWA AR15 Commando;

  • (z.655) PWA Commando;

  • (z.656) PWS MARK 1;

  • (z.657) PWS MARK 2;

  • (z.658) PWS MARK 1 Современный мушкет;

  • (г.659) PWS PCC9;

  • (z.66) Пистолет PWS MARK 1;

  • (z.661) PWS MARK 1 Современный мушкетный пистолет;

  • (z.662) PWS MARK 1 Mod 2-M;

  • (z.663) Q Honey Badger;

  • (z.664) Пистолет Quartercircle10 GSF;

  • (z.665) Quentin Defense QD-15;

  • (z.666) Quentin Defense SBR;

  • (z.667) Quentin Defense ZRT;

  • (г.668) Радиан 1;

  • (z.669) Радикальное огнестрельное оружие РФ-15;

  • (z.67) Радикальное огнестрельное оружие РМ-15;

  • (z.671) Радикальное огнестрельное оружие РМР-10;

  • (z.672) Свержение Ренье оружия;

  • (z.673) Ренье Армс РБ-15;

  • (z.674) Rainier Arms RB308;

  • (z.675) Rainier Arms RM-15;

  • (z.676) Rat Worx M-7;

  • (z.677) Red River Tactical RRT-TAC15;

  • (г.678) Красный Олень Технологии Красный Олень;

  • (z.679) Видеомагнитофон Remington R15;

  • (z.68) Remington LRP-07;

  • (z.681) Remington R4;

  • (z.682) Remington R25;

  • (z.683) Remington R25 G2;

  • (z.684) Оружейная Революции AR-410;

  • (z.685) RGM Incorporated Marksman;

  • (z.686) Пушки TRR15;

  • (z.687) Rhino Arms RA-4;

  • (г.688) Rhino Arms RA-4R;

  • (z.689) Rise Armament Ripper;

  • (z.69) RND Edge;

  • (z.691) Rock Island Armory M15A1;

  • (z.692) Rock Island Armory XM15;

  • (z.693) Rock Island Armory XM15E2;

  • (z.694) Rock River Arms LAR-15;

  • (z.695) Rock River Arms LAR-15 Правоохранительные органы;

  • (z.696) Rock River Arms LAR-15 Varmint;

  • (г.697) Рок Ривер Армс ЛАР-15 / 9ММ;

  • (z.698) Пистолет Rock River Arms LAR-15;

  • (z.699) Rock River Arms LAR-15 Elite;

  • (z.7) Rock River Arms LAR-15 Coyote;

  • (z.701) Rock River Arms LAR-15 Predator Pursuit;

  • (z.702) Rock River Arms LAR-458;

  • (z.703) Rock River Arms LAR-6.8;

  • (z.704) Rock River Arms LAR-8;

  • (г.705) Rock River Arms LAR-15 ATH;

  • (z.706) Rock River Arms Оператор LAR-15;

  • (z.707) Rock River Arms Оператор LAR-8;

  • (z.708) Rock River Arms LAR-47;

  • (z.709) Rock River Arms LAR-15LH;

  • (z.71) Rock River Arms LAR-15 Hunter;

  • (z.711) Rock River Arms LAR-15 серии Фреда Эйхлера;

  • (z.712) Rock River Arms LAR-15 R3 Competition;

  • (г.713) Rock River Arms LAR-15 Техас;

  • (z.714) Rock River Arms LAR-15 Tactical;

  • (z.715) Rock River Arms LAR-15 Правительство;

  • (z.716) Rock River Arms LAR-15 TASC;

  • (z.717) Национальный матч Rock River Arms LAR-15;

  • (z.718) Rock River Arms LAR-15 DEA;

  • (z.719) Rock River Arms LAR-9;

  • (z.72) Пистолет Rock River Arms LAR-9;

  • (г.721) Рок Ривер Армс ЛАР-40;

  • (z.722) Rock River Arms LAR-PDS;

  • (z.723) Пистолет Rock River Arms LAR-40;

  • (z.724) Rock River Arms LAR-6;

  • (z.725) Rock River Arms ЛАР-8М;

  • (z.726) Rock River Arms LAR-10;

  • (z.727) Rocky Point Guns LE15;

  • (z.728) Roggio RA15;

  • (z.729) Royal Arms Rak15;

  • (г.73) Ruger SR556;

  • (z.731) Ruger SR556 VT;

  • (z.732) Ruger AR556;

  • (z.733) S&J Hardware SJ-15;

  • (z.734) Sabatti SAR;

  • (z.735) Sabertooth Defense M4;

  • (z.736) Sabre Defense Industries SR-15;

  • (z.737) Sabre Defense Industries XR10;

  • (z.738) Sabre Defense Industries XR15;

  • (г.739) Сафир Т12;

  • (z.74) Safir T14;

  • (z.741) Salient Arms International GRY;

  • (z.742) Salient Arms International SAI-T2;

  • (z.743) Savage MSR-10;

  • (z.744) Savage MSR-15;

  • (z.745) Schmeisser AR15;

  • (z.746) Schmeisser MR-BA19;

  • (z.747) Seekins Precision NX15;

  • (z.748) Seekins Precision SBA15;

  • (г.749) Seekins Precision SP15;

  • (z.75) Seekins Precision SP223;

  • (z.751) Seekins Precision SPX;

  • (z.752) Sendra Corp M15A1;

  • (z.753) Sendra Corp XM15E2;

  • (z.754) SFRC SFRC-15;

  • (z.755) SGW AR15;

  • (z.756) SGW AR15A1;

  • (z.757) SGW AR15A2;

  • (z.758) SGW CAR15;

  • (г.759) SGW CAR15 AR;

  • (z.76) SGW K3B;

  • (z.761) SGW Ultra Match Rifle;

  • (z.762) SGW XM15A1;

  • (z.763) Sharps Bros The Jack;

  • (z.764) Sharps Bros Warthog;

  • (z.765) Sharps Rifle Company Sharps 15;

  • (z.766) ShoeLess Ventures FAB10;

  • (z.767) Shooting Edge OA15;

  • (z.768) SI Defense SI AR-15;

  • (г.769) SI Defense SI-D;

  • (z.77) SI Defense SI-HK;

  • (z.771) SI Defense SI-C;

  • (z.772) SIG Sauer SIG 516;

  • (z.773) SIG Sauer SIG 716;

  • (z.774) SIG Sauer SIG M400;

  • (z.775) SIG Sauer SIG M400 Elite;

  • (z.776) Six Sigma Arms P18-32;

  • (z.777) Smith & Wesson M&P 15T;

  • (г.778) Smith & Wesson M&P 15;

  • (z.779) Smith & Wesson M&P 15-22;

  • (z.78) Smith & Wesson M&P 15FT;

  • (z.781) Smith & Wesson M&P 15-22PC;

  • (z.782) Smith & Wesson M&P 15 Magpul;

  • (z.783) Smith & Wesson M&P 10;

  • (z.784) Smith & Wesson M&P 15A;

  • (z.785) Smith & Wesson M&P 15PC;

  • (г.786) Smith & Wesson M&P 15OR;

  • (z.787) Smith & Wesson M&P 15PS;

  • (z.788) Smith & Wesson M&P 10 Creedmoor;

  • (z.789) Smith & Wesson M&P 15i;

  • (z.79) СМОС СМ-15;

  • (z.791) SMOS Rogue-15;

  • (z.792) SMOS Rogue-50;

  • (z.793) Снайперская Центральная СИ-С;

  • (z.794) SNS Industries Max 15;

  • (г.795) SNS Industries LFT-15;

  • (z.796) SNS Industries NO-15;

  • (z.797) Пистолет SNS Industries Max 15;

  • (z.798) Socom Firearms Corporation Recon AR15;

  • (z.799) Socom Manufacturing BR-15-A6S;

  • (z.8) Spartan Precision SP15;

  • (z.801) Special Ops Tactical SO15;

  • (z.802) Spike’s Tactical ST-15;

  • (z.803) Spike’s Tactical SL-15;

  • (г.804) Spike’s Tactical ST-22;

  • (z.805) Spike’s Tactical CJ15;

  • (z.806) Tactical Hellbreaker Спайка;

  • (z.807) Тактический бородавочник Спайка;

  • (z.808) Spike’s Tactical The Jack;

  • (z.809) Spike’s Tactical Spartan;

  • (z.81) Тактический домкрат Спайка 10;

  • (z.811) Компания по производству оружия Spirit SGM9;

  • (z.812) Springfield Armory Saint;

  • (г.813) Оружие STAG-6L;

  • (z.814) STAG Arms STAG-6.8;

  • (z.815) STAG Arms STAG-9;

  • (z.816) STAG Arms STAG-10;

  • (z.817) STAG Arms STAG-10S;

  • (z.818) STAG Arms STAG-15;

  • (z.819) STAG Arms STAG-223;

  • (z.82) Sterling Arms SAI 102;

  • (z.821) Специальная винтовка STI International AR15;

  • (г.822) Прецизионное огнестрельное оружие Stillers Predator XT;

  • (z.823) Stoner SR-25;

  • (z.824) Stoner SR-15;

  • (z.825) Stoner MARK 11 Model 0;

  • (z.826) Стоунер M110;

  • (z.827) Stoner XM110;

  • (z.828) Stoner MARK 11 Модель 1;

  • (z.829) Sun Devil SD15;

  • (z.83) Sun Devil SD308;

  • (z.831) Superior Arms S-15;

  • (г.832) Излишки боеприпасов и оружия LOW15;

  • (z.833) Излишки боеприпасов и оружия LOW16;

  • (z.834) Излишки боеприпасов и оружия SA15;

  • (z.835) Оружие спецназа SF-15;

  • (z.836) SWORD International MARK 15 Model 0;

  • (z.837) SWORD International MARK 16 Model 0;

  • (z.838) SWORD International MARK 17 Model 0;

  • (z.839) SWORD International MARK 18 Model 0;

  • (г.84) МЕЧ МЕЖДУНАРОДНАЯ МАРКА 18 Модель 0 Мьёльнир;

  • (z.841) Тактический армз ТА-15;

  • (z.842) Тактические новинки Т-15;

  • (z.843) Tactical Innovations T-15BDX;

  • (z.844) Тактическая обработка ТМ-15;

  • (z.845) Тактическая обработка TM308;

  • (z.846) Тактическая механическая обработка ТСГ-15;

  • (z.847) Тактические винтовки правительственные;

  • (г.848) Тактические винтовки Tactical M4C;

  • (z.849) Tactical Rifles Тактическая САУ;

  • (z.85) Винтовки тактические СВР;

  • (z.851) Talon Arms TA-15;

  • (z.852) Taran Tactical TR-1;

  • (z.853) Tech Designs AR-15;

  • (z.854) Территориальные оружейники SLR15;

  • (z.855) Карабин Thor TR15;

  • (z.856) Tippmann Arms M4-22;

  • (г.857) Оружейная палата Титусвилля ТА-15;

  • (z.858) ТКС Инжиниринг AR15HD;

  • (z.859) TNW SGP15;

  • (z.86) Tom Sawyer M4-Z1;

  • (z.861) Том Сойер Веселый Роджер;

  • (z.862) Trojan Firearms PRO9V1;

  • (z.863) Trojan Firearms TFA-PCC9G;

  • (z.864) Trojan Firearms ULV1;

  • (z.865) Troy Defense Troy 102;

  • (г.866) Тройский карабин Защиты Трои;

  • (z.867) Карабин M4A1 Troy Defense Troy;

  • (z.868) Troy Defense Troy M4A1 SOCC;

  • (z.869) Troy Defense Troy M7A1 CQB;

  • (z.87) Карабин Troy Defense Troy M7A1 PDW;

  • (z.871) Troy Defense Troy M16A2 Могадишо;

  • (z.872) Троя Дефанс Северная Гвардия Трои;

  • (z.873) Troy Industries Troy CQB-SPC;

  • (г.874) True North Arms TNA-15;

  • (z.875) Turnbull Manufacturing TAR-15;

  • (z.876) Turnbull Manufacturing TAR-10;

  • (z.877) Umbrella Corporation AR15;

  • (z.878) Umlaut Industries U4;

  • (z.879) Unik Alpha;

  • (z.88) United Defense S7;

  • (z.881) US Arms Patriot 15;

  • (z.882) Автооружие США USM4;

  • (г.883) Академия огнестрельного оружия США BB-16;

  • (z.884) Тактическое огнестрельное оружие США USA-15;

  • (z.885) UT Arms GEN-1AR;

  • (z.886) Utas XTR-12;

  • (z.887) V Seven Weapons GI Seven;

  • (z.888) VC Defense VC-15;

  • (z.889) Vidalia Police Supply VPS-15;

  • (z.89) VM Hy-Tech VM15;

  • (z.891) Vulcan Armament V15;

  • (г.892) Web Arms WA-15;

  • (z.893) Wilson Combat AR15 UT;

  • (z.894) Wilson Combat AR15 TPR;

  • (z.895) Wilson Combat AR15 M4;

  • (z.896) Wilson Combat AR15 TL;

  • (z.897) Wilson Combat AR15 SM;

  • (z.898) Wilson Combat AR15 SS;

  • (z.899) Wilson Combat AR15;

  • (z.9) Wilson Combat AR-10;

  • (г.901) Wilson Combat AR9G;

  • (z.902) Wilson Tactical WT-15;

  • (z.903) Windham Weaponry MCS;

  • (z.904) Windham Weaponry WW-15;

  • (z.905) Windham Weaponry WW-308;

  • (z.906) Windham Weaponry WW-CF;

  • (z.907) WMA WMA-15;

  • (z.908) Тактическое огнестрельное оружие Росомаха WAR-15;

  • (z.909) Тактическое огнестрельное оружие Росомахи WT-15;

  • (г.91) Xtreme Gun XG15;

  • (z.911) Xtreme Machining XR15;

  • (z.912) YHM 57;

  • (z.913) YHM YHM-15;

  • (z.914) ZEV Technologies Mega-LF;

  • (z.915) ZEV Technologies Mega-TR15;

  • (z.916) ZEV Technologies ZEV-BL;

  • (z.917) ZEV Technologies ZEV-FL;

  • (z.918) ЗМ Оружие LR300ML;

  • (z.919) ЗМ Оружие LR300SR; и

  • (z.92) Zombie Defense Z-4.

  • Отличные пушки!


    Западный фронт, Франция, 1918: солдаты американского экспедиционного корпуса стреляют из французского 75-мм полевого орудия M-1897, революционного высокоточного скорострельного оружия с эффективной дальностью стрельбы почти 7000 метров. (Армия США / Национальный архив)

    ИОСИФ СТАЛИН НАЗЫВАЛ АРТИЛЛЕРИЮ «богом войны». Часто цитируют, что маршал Анри Петен сказал: «Артиллерия побеждает, пехота занимает». Людовик XIV приказал Ultima ratio regum (последний аргумент королей) на всех французских пушках, в то время как средневековый папа, как сообщается, издал полное отлучение от церкви для всех артиллеристов как слуг дьявола.Скорее всего, согласится любой, кто когда-либо подвергался постоянному артиллерийскому обстрелу.

    На самом базовом уровне артиллерийское орудие — это оружие, обслуживаемое экипажем, которое выбрасывает относительно большие снаряды на большие расстояния. Вся современная артиллерия является прямым потомком древних боевых машин, описанных в таких библейских отрывках, как 2 Паралипоменон 26:15: «Устройства, изобретенные для использования на башнях и на угловых оборонительных сооружениях, чтобы солдаты могли стрелять стрелами и метать большие камни из-под земли. стены.Артиллерийские орудия до пороховой эры включали баллисту, по сути, огромный арбалет, метавший снаряд по относительно плоской траектории, а также катапульту и требушет, которые метали ракеты по более изогнутой траектории, что позволяло поражать цели позади стены и холмы.

    В этом старом оружии использовалась механическая сила как средство запуска твердых, невесомых снарядов. Современная артиллерия использует взрывную химическую энергию и запускает снаряды, которые могут нести взрывчатые, дымовые и осветительные заряды; противотанковые мины; радиолокационные устройства; и терминальные системы наведения с лазерным и спутниковым управлением.

    Одно из самых ранних описаний пороха на Западе было написано Роджером Бэконом в 1245 году. Вскоре после этого стало появляться оружие, в котором взрывная сила пороха использовалась для выведения снаряда из какой-либо трубы (слово «пушка» происходит от латинское canna , что означает язычок или полая трубка). Ранние пушки изготавливались либо из литого металла, либо из деревянных клепок. Вплоть до XVII века артиллерия редко играла какую-либо роль на поле боя, кроме осадных операций.

    За последние 400 лет существует три основных категории ствольной артиллерии. Пушки, как и древние баллисты, представляют собой артиллерийские орудия, которые стреляют снарядами с очень высокой скоростью и относительно плоской траекторией. Минометы доставляют относительно легкие взрывающиеся снаряды на коротких дистанциях и только при больших углах выстрела, то есть угол подъема их стволов всегда больше 45 градусов. Гаубицы — чрезвычайно универсальное оружие, способное стрелять под малыми углами, как пушка, или под большими углами, как миномет и более ранние катапульты и требушеты.Начальная скорость и дальность полета у гаубицы меньше, чем у орудия сопоставимых размеров, но точность выше. Ранние гаубицы с 17 по середину 19 веков были способны стрелять как твердыми выстрелами, так и разрывными снарядами.

    Большинство орудий полевой артиллерии, использовавшихся после окончания Второй мировой войны, — это гаубицы, хотя некоторые полевые орудия все же существуют. Все танки вооружены орудиями, а их экипажи стреляют прямой наводкой по цели. Хотя технически это артиллерийские орудия, современные минометы классифицируются как пехотное оружие в большинстве современных армий.

    Это одни из самых технологически и тактически значимых артиллерийских орудий за последние 550 лет.

    Бомбард

    Основной проблемой ранних пушек была закупка боеприпасов. Пушечные ядра были вырезаны из цельного камня, и их было трудно правильно определить по размеру. Решением этой проблемы была бомбардировка. Появившееся в Китае примерно в 13 веке, это оружие имело слегка конический канал ствола, более узкий сзади и расширяющийся к дулу.В канал ствола можно было вставлять шары разных размеров, и в какой-то момент по его длине снаряд плотно садился. Конечно, расширение канала ствола позволяло большей части расширяющегося газа из воспламененного пороха в казенной части улетучиваться при движении шара, что уменьшало мощность снаряда.

    Производители оружия компенсировали это за счет создания все более крупных и мощных бомбардировщиков. К концу 15 века некоторые бомбардировщики весили до 20 тонн и стреляли 25-дюймовым шаром весом около 800 фунтов, что сделало их первым суперпушком в истории.Они были убийцами замков, и их появление ознаменовало начало конца замка как важного в военном отношении укрепления — и упадка всей феодальной системы.

    Османский султан Мехмет II был первым великим стрелком в истории. В 1453 году он использовал одни из самых больших бомбардировок, когда-либо построенных, чтобы разрушить оборону Константинополя, положив конец Византийской империи. Одним из величайших нововведений Мехмеда было отливка бомбард из двух частей, которые соединялись винтами.Это упростило их транспортировку, а также более быстрое и легкое заряжание и стрельбу.

    Кожаное орудие Густава Адольфа

    Король Швеции Густав II Адольф (1594–1632) был первым военачальником, который разделил свою артиллерию на две отдельные ветви — полевая и осадная. Теперь артиллерия впервые сопровождала маневрирование войск на открытом поле боя. Но вес и мобильность по-прежнему оставались проблемой. Типичным полковым поддерживающим орудием начала 17 века было относительно небольшое 4-фунтовое орудие (то есть оно производило сплошной выстрел весом четыре фунта), но только его чугунная труба могла весить до 1500 фунтов.

    Так называемое кожаное ружье, 2,6 фунта, представленное Густавом во время польско-шведской войны 1626–1629 годов, было первым в мире легким и высокомобильным полевым орудием. Трубка была сделана из литой меди, усилена железными лентами и плотно обернута веревочными обвязками, обтянутыми кожей. Он весил всего около 90 фунтов. Установленное на двухколесном лафете, орудие могло перемещаться одной лошадью и устанавливаться всего двумя людьми. Конечно, кожаное ружье имело меньшую дальность действия и было менее точным или мощным, чем обычные чугунные орудия, но его способность быстро перемещаться в критические точки на поле боя восполняла его недостатки.Его самым большим недостатком была чувствительность к теплу от огня; всего после 10–12 выстрелов трубку пришлось снимать с каретки, чтобы она остыла. Несмотря на технологический тупик, кожаное ружье способствовало тактическим инновациям, которые были первыми шагами к современной концепции общевойскового оружия.

    Конная артиллерия Фридриха Великого

    Как и Густав, король Пруссии Фридрих II (1712–1786) — Фредерик Великий — назначил орудия для сопровождения своих пехотных полков, обычно по два трехфунтовых, а иногда и шестифунтовых, каждому батальону.Но введение им конной артиллерии в 1759 году стало значительным скачком в мобильности огневой мощи, и в течение следующих 30 лет Пруссия располагала единственной в Европе конной артиллерией.

    Фредерик посадил всех своих артиллеристов либо на лидеров четырехконных отрядов, либо на лафеты. Впервые артиллерия была достаточно мобильной, чтобы сопровождать кавалерию. Повышенная скорость привела к еще одной тактической проблеме: доставить орудие, стрелков и боеприпасы в одно и то же место в одно и то же время. Эта проблема была решена с помощью передок, двухколесной повозки, в которой был установлен ящик, в котором находились готовые боеприпасы секции.Лошадей цепляли прямо за передок, а ружье цепляли за буксирный крюк в задней части передка. В верхней части ящика с боеприпасами также было место для двух стрелков. Следующим был кессон. Нечто похожее на двухколесное, оно имело два ящика для боеприпасов, установленных на двухколесном лафете.

    Наполеон 12-фунтовая

    В 1853 году Франция при Наполеоне III представила на поле боя Canon-obusier de 12, гладкоствольную 12-фунтовую пушку с дульным зарядом, способную стрелять как выстрелами, так и снарядами.Армия США приняла на вооружение 12-фунтовую пушку Наполеона в 1857 году, и это было стандартным полевым орудием для обеих сторон во время Гражданской войны. Он оставался на вооружении почти до конца XIX века, когда с появлением нарезов и технологий заряжания с казенной части эра дульного заряжания подошла к концу.

    Наполеон стрелял тремя основными вариациями сплошного выстрела. 12-фунтовый твердый железный шар был смертельно опасен на расстоянии 1500 метров от плотно упакованных пехотных соединений того времени. По сути, баллончик представлял собой жестяную банку, набитую мушкетными пулями, превращавшую ружье в огромный дробовик.Расчеты перешли на канистру, когда атакующая пехота противника приблизилась на 300 метров. Виноградная дробь была разновидностью канистры, обычно с дюжиной 1,5-дюймовых железных шариков. Виноград был особенно эффективен против кавалерии на дальностях до 600 метров.

    Более поздний вариант, выстрел из сферической гильзы, представлял собой нечто среднее между канистровым снарядом и взрывчатым снарядом: полая сфера, заполненная мушкетоподобными шарами и зарядом взрывчатого вещества, срабатывающим от порохового взрывателя, сферический гильза взорвалась в воздухе над головами. выставленных войск до 1000 метров.Он был изобретен в 1780-х годах офицером Королевской артиллерии Генри Шрапнелем, имя которого стало синонимом осколочного снаряда.

    Пистолет Родман

    В начале 1860-х годов капитан армии США Томас Родман разработал орудие, которое должно было стать кульминацией гладкоствольной артиллерии с дульным заряжанием. К тому времени бронза заменила чугун в стволах орудий, потому что последний был слишком хрупким, чтобы выдерживать удары, вызванные более быстро горящими черными порохами, которые были разработаны.При обычных методах литья чугунный бочонок охлаждается снаружи внутрь, неравномерно усаживается и образует трещины и полости, вызывающие ослабление конструкции. Родман разработал метод изготовления более прочных труб путем литья чугуна вокруг водоохлаждаемого сердечника, так что ствол охлаждается изнутри наружу, что делает внутренний материал более плотным, а трубу в целом намного прочнее. Стандартные калибры Родмана составляли 8, 10, 15 и 20 дюймов, последнее из которых было самым крупным калибром из когда-либо отлитых в Соединенных Штатах.Хотя орудия Родмана, как правило, были слишком тяжелыми для полевых орудий, они широко использовались обеими сторонами в качестве осадных, гарнизонных и прибрежных орудий во время Гражданской войны и оставались на вооружении до конца века.

    Пистолет Армстронг

    Всего за несколько лет до того, как Родман начал отливать свое более прочное железное ружье, британский инженер сэр Уильям Армстронг разработал первую в мире практическую пушку с казенной частью, изготовленную в Великобритании с 1855 года. Ствол ружья Армстронга был изготовлен из кованого железа, созданного компанией усадку последовательных слоев металла друг на друга.В результате получилась более прочная и надежная труба, чем из обычного чугуна, и, будучи тверже бронзы, она делала нарезку более практичной. Нарезная артиллерия, представленная несколькими годами ранее, улучшила дальность и точность стрельбы.

    Система заряжания казенной части

    Армстронга состояла из вентиляционной детали, плотно удерживаемой на месте с помощью полого винтового механизма на казенной стороне ствола. Вентиляционная вставка была предшественницей современного затвора с клиновым скользящим движением. Британцы использовали пушки Армстронга до 1920 года.

    Французское 75-мм полевое орудие M-1897

    К середине XIX века европейские оружейники экспериментировали со сталью, хотя ее было трудно производить в постоянных количествах. В 1856 году немецкий промышленник Альфред Крупп представил первое надежное стальное ружье, а к 1890-м годам все стволы орудий стали делать из стали.

    Стальное орудие Canon de 75 modèle 1897, известное как French 75, было первым в мире современным артиллерийским орудием.Разработанное и изготовленное на арсеналах французского правительства, оно мгновенно сделало все остальные орудия в мире устаревшими, и вся современная полевая артиллерия является производным от него. При весе всего 2700 фунтов его буксировала команда из шести лошадей, и он выпустил 75-мм снаряд весом 15,8 фунтов на дальность 6850 метров. Его орудие из семи человек могло стрелять от шести до 15 выстрелов в минуту.

    Самым важным нововведением в ружье была его революционная гидропневматическая система отдачи, которая позволяла стволу пистолета перемещаться назад, в то время как лафет оставался твердо на земле.После того, как трубка откатилась, система вернула ее вперед. Большим тактическим преимуществом этой системы было то, что орудие не нужно было перенацеливать каждый раз при стрельбе.

    Другие инновации, представленные в French 75, включали быстродействующий затвор винтового типа; фиксированный снаряд боеприпасов (снаряд, метательный заряд и взрыватель — все в одном предварительно упакованном блоке), который может быть заряжен одним движением; оптическая система прямой видимости, система наводки; и стальные щиты для защиты артиллерийских расчетов от огня вражеского стрелкового оружия.

    Во время Первой мировой войны пулеметный огонь заставил всю артиллерию отступить с линии фронта. Французская 75-я, как и вся легкая артиллерия, не имела более высокой траектории, необходимой для ведения огня с закрытых позиций, особенно на пересеченной местности.

    Большая 420-мм осадная гаубица Bertha

    Официально обозначенная 42cm Mörser L / 14, тяжелая осадная гаубица, более известная под прозвищем Dicke Bertha (Большая Берта), была разработана управляющим директором Krupp, блестящим инженером-артиллеристом профессором Фрицем Раузенбергером.Представленная в 1914 году, Big Bertha в действии весила 93 720 фунтов. Его перевезли пятью частями и собрали на месте с помощью крана, перевозимого тягачом-тягачом. Он был способен стрелять 420-миллиметровым снарядом весом 1719 фунтов на дальность 9 500 метров с высокой точностью. Снаряд имел закаленную коническую носовую часть с взрывателем в основании снаряда, что делало его особенно эффективным для пробивания железобетонных укреплений.

    Около 10 Больших Бертов были выставлены немецкой армией во время Первой мировой войны.Вопреки распространенному мнению, это были не те орудия, которые обстреляли Париж с расстояния 75 миль в 1918 году.

    Paris Gun

    Также разработанный Rausenberger Круппа, официально обозначенный Wilhelmgeschütz (Kaiser Wilhelm Gun) был одним из самых замечательных артиллерийских орудий, когда-либо построенных. Его максимальная дальность в 126 000 метров намного превышала таковую у любой созданной ранее пушки. Или с тех пор. В период с марта по июль 1918 года немцы использовали три из них против Парижа, благодаря чему они получили название «Парижские пушки».Очень немногие обычные артиллерийские орудия, запущенные на войне, смогли достичь даже половины своей дальности.

    Paris Gun был построен путем вставки 210-мм гильзы в просверленный 380-мм ствол морской пушки. Гильза выступала примерно на 39 футов за дульную часть основного ствола. Затем к передней части удлиненного гильзы был добавлен 19-футовый гладкоствольный удлинитель, в результате чего длина композитного ствола составила 130 футов. Весь композитный ствол требовал внешней стропильной системы, чтобы держать его прямо.

    Практически все артиллерийские орудия достигают максимальной дальности, когда ствол поднимается под углом 45 градусов. Все, что превышает 45 градусов, классифицируется как огонь под большим углом, и по мере увеличения высоты дальность действия уменьшается. Однако «Парижская пушка», похоже, бросила вызов обычным законам баллистики, достигнув максимальной дальности на высоте 50 градусов. Причина заключалась в том, что под углом 50 градусов снаряд «Парижской пушки» попал в стратосферу значительно выше, чем под углом 45 градусов.Уменьшение плотности воздуха на больших высотах привело к гораздо меньшему сопротивлению корпуса снаряда, что привело к большей горизонтальной дальности.

    Миномет Стокса

    К концу XIX века большинство армий мира сочли миномет устаревшим. Способный вести огонь только под большими углами и относительно короткими дистанциями, миномет всегда был тяжелым и неподвижным оружием, плохо подходящим для маневренной войны. Однако во время Первой и Второй Балканских войн 1912 и 1912–1913 годов немецкие военные наблюдатели поняли, что миномет по-прежнему тактически полезен в статических ситуациях и на изолированной местности.Поэтому немцы начали Первую мировую войну с гораздо большим количеством минометов, чем любая другая армия. С появлением позиционной войны миномет оказался идеальным оружием непосредственной поддержки. Стрельба под большими углами не нуждалась в системе отдачи, потому что удар от выстрела был направлен прямо в землю. Поскольку он был компактным, его можно было размещать в передовых окопах. Но немецкие минометы по-прежнему были тяжелым, сложным оружием, мало напоминавшим современные минометы.

    В начале 1915 года британский инженер сэр Уилфред Стоукс изобрел предшественник сегодняшнего «дымоходного» раствора.Простая 3-дюймовая гладкоствольная стальная труба Стокса весила всего 100 фунтов и имела неподвижный ударник внизу. Он стрелял самотечным снарядом с капсюлем в основании и метательным зарядом, упакованным в мешки вокруг его задних стабилизирующих стабилизаторов. Дальность выстрела составляла 700 метров, радиус взрыва — от 5 до 10 метров, а максимальная скорострельность — 25 выстрелов в минуту.

    Пистолет Березовый

    Разработанное и построенное в Королевском арсенале в Вулидже в 1925 году, орудие Birch стало первой в мире практичной самоходной артиллерийской установкой.Он был назван в честь генерала сэра Ноэля Берча, одного из самых выдающихся британских артиллеристов Первой мировой войны и генерал-генерал-артиллериста после войны.

    Орудие Birch представляло собой стандартное 18-фунтовое (83,8 мм) британское полевое орудие, установленное на модифицированном шасси среднего танка Vickers. У него была открытая площадка для стрельбы и экипаж из семи человек. Вся современная самоходная артиллерийская установка произошла прямо от орудия «Береза».

    немецкий 88 мм

    Самая известная пушка Второй мировой войны, 88-мм немецкое орудие производства Krupp, на самом деле представляла собой семейство чрезвычайно эффективных орудий, в которое входили зенитная пушка, танковая пушка, противотанковая пушка и, в крайнем случае, орудие полевой артиллерии.Установленный на самых разных буксируемых и самоходных лафетах, 88 требовал различных боеприпасов и различного оборудования для управления огнем для различных задач. На протяжении всей войны он модернизировался как Flak 36, Flak 37 и Flak 41.

    Настоящая пушка, а не гаубица, 88 имела плоскую траекторию и очень высокую начальную скорость, что делало ее эффективной и вызывающей опасение зенитной и противотанковой пушкой.

    Американский буксируемый M-2A1 / M-101A1 105 мм

    Буксируемая 105-мм гаубица M-2A1 и ее слегка обновленный вариант, M-101A1, были опорой американской дивизионной артиллерии прямой поддержки от Второй мировой войны до войны во Вьетнаме.На вооружении более 50 различных армий они были самыми широко используемыми орудиями полевой артиллерии в истории.

    Буксируемый М-2А1 был мечтой солдат. Все, кто когда-либо служил на нем, влюблялись в него. Он был прост в эксплуатации, обслуживании и почти не поддавался разрушению. Он выпустил 33-фунтовый высокопрочный снаряд на максимальную дальность 11 270 метров, а его экипаж из восьми человек мог произвести до 10 выстрелов в минуту и ​​три выстрела в минуту непрерывного огня. В 1962 году он был немного модернизирован и получил новое обозначение M-101A1.Хотя последний M-101A1 был снят с вооружения США в 1990-х годах, он по-прежнему используется во многих других частях мира, а американские арсеналы продолжают производить запасные части для продажи за границу.

    Атомная Энни

    После того, как в 1945 году была взорвана первая атомная бомба, почти сразу же начались разработки ядерных артиллерийских снарядов и орудий, способных стрелять ими. Разработанная в конце Второй мировой войны сверхтяжелая американская 280-мм пушка М-65 так и не была запущена в производство, как предполагалось изначально.В 1953 году он был принят на вооружение, модифицированный специально для стрельбы 803-фунтовым снарядом Т-124 с ядерной боеголовкой W-9. По прозвищу Атомная Энни, М-65 также мог стрелять обычным фугасным снарядом массой 598 фунтов на дальность 28 700 метров. Транспортируемая на двух специально разработанных тракторах, орудие весило 93 800 фунтов в батарее и стреляло из коробчатого лафета.

    Первый и единственный настоящий ядерный выстрел из пушки произошел 25 мая 1953 года на Френчменс Флэтс, штат Невада.Выстреливаемая на дальность 10 000 метров и взорвавшаяся на высоте 160 метров над землей, взорвавшийся снаряд произвел мощность 15 килотонн. М-65 оставался на вооружении немногим более 10 лет, но он доказал техническую осуществимость — хотя и не обязательно базовый здравый смысл — тактического ядерного оружия.

    Американская 8-дюймовая гаубица М-1 / М-110

    Американская 8-дюймовая гаубица имеет репутацию самого точного артиллерийского орудия в истории. Впервые принятая на вооружение в 1940 году как буксируемая гаубица М-1, она стреляла 200-фунтовым осколочно-фугасным снарядом на максимальную дальность 16 800 метров.Его чрезвычайно малая круговая вероятная ошибка делала его идеальным оружием для разрушительного огня по укрепленным целям. Он также был способен стрелять химическим снарядом, несущим нервно-паралитический газ зарин, и ядерным снарядом с боеголовкой W-33 мощностью 40 килотонн. В 1963 году орудие и его лафет были установлены на гусеничном шасси и получили обозначение самоходной гаубицы М-110.

    В 1970-х 8-дюймовый был модернизирован с более длинным стволом и переименован в M-110A1; несколько лет спустя он был модернизирован как М-110А2.M-110 был выведен из эксплуатации армии США сразу после Первой войны в Персидском заливе, и многие артиллеристы до сих пор считают это серьезной ошибкой. Он использовался более чем 20 армиями и до сих пор остается на вооружении некоторых.

    Американские самоходные гаубицы М-109

    Семейство 155-мм гаубиц М-109 — самые широко используемые самоходные артиллерийские орудия в истории. С тех пор, как они были впервые представлены в 1963 году, они состояли на вооружении 33 армий и остаются таковыми с большинством из них сегодня.В отличие от 8-дюймового M-110, M-109 имеет легкобронированную закрытую башню вокруг своей огневой платформы, обеспечивающую большую защиту орудийному расчету. Его внешний вид заставляет многих принимать его за легкий танк, хотя и с очень большой пушкой.

    Первоначальная модель имела относительно короткий ствол, который стрелял 97-фунтовым осколочно-фугасным снарядом на максимальную дальность 14 600 метров. Все M-109 были способны стрелять химическими и ядерными снарядами, хотя оба снаряда были уничтожены из U.С. арсенал в 1990-е гг. Тогда же была представлена ​​текущая версия M-109A6 Paladin. Благодаря своей автоматизированной системе заряжания, «Паладину» требуется экипаж из четырех человек, а его сложные системы навигации и автоматического управления огнем дают ему возможность останавливаться и стрелять в течение 30 секунд.

    Канадский GC-45 / Южноафриканский G-5

    Канадская 155-мм буксируемая гаубица GC-45 и ее южноафриканский вариант G-5 ознаменовали радикальный прогресс в технологии артиллерийской баллистики.GC-45 был разработан в 1970-х годах блестящим, но вызывающим споры канадским инженером по боеприпасам доктором Джеральдом Буллом. Поклонник и серьезный ученик Раузенбергера Круппа, Булл был нанят Саддамом Хусейном с соблазном почти неограниченного финансирования для разработки и создания проекта Вавилон, 350-мм суперпушки с дальностью стрельбы в 1000 километров. Бык был убит в номере отеля Брюсселя в марте 1990 года; Главным подозреваемым остается израильский «Моссад».

    Величайшим нововведением

    Bull была разработка полнопроходного снаряда увеличенной дальности и сопутствующей технологии стрельбы из пушки, способной стрелять такими боеприпасами.Гаубица GC-45 полностью изменила стандартную концепцию нарезов, стреляя снарядом с небольшими ребрами, которые заходили в канавки канала ствола, в отличие от снаряда небольшого размера, который попадал в землю между канавками. Результатом стало значительное увеличение дульной скорости и дальности полета. Варианты, основанные на GC-45, использовались иракцами в Первой и Второй войнах в Персидском заливе, и они превосходили все орудия в арсенале союзной коалиции.

    Панцерхаубитце 2000

    Вступившая в строй в 1998 году, немецкая 155-мм бронированная гаубица PzH 2000 является самой технологически совершенной ствольной артиллерийской установкой, которая находится на вооружении на сегодняшний день.Гусеничная самоходная система с полностью закрытой бронированной башней PzH 2000 заменила M-109A6 Paladin в некоторых армиях мира. Благодаря автоматической системе подачи и заряжания боеприпасов и современной системе управления огнем GPS, PzH 2000 обладает высокой скорострельностью, способной стрелять очередью из трех выстрелов за девять секунд и 10 выстрелов за 56 секунд. У него постоянная скорострельность от 10 до 13 выстрелов в минуту. Максимальная дальность составляет 30 000 метров для обычных осколочно-фугасных снарядов и 40 000 метров для реактивных снарядов.

    PzH 2000 впервые был запущен голландской армией в августе 2006 года по целям талибов в провинции Кандагар, Афганистан.

    Генерал-майор Дэвид Т. Забецки (в отставке армии США) — главный военный историк Группы всемирной истории. Он имеет докторскую степень по военной истории Британского Королевского военного колледжа наук и преподавал в Военно-морской академии США. В качестве капитана командовал батареей М-101А.

    Измерения кинетики самосборки отдельных вирусных капсидов вокруг их РНК-генома

    Значимость

    Самосборка — это процесс, в котором функциональные наноразмерные структуры строятся сами по себе, движимые броуновским движением и взаимодействиями между компонентами.Первоначально этот термин был придуман для описания образования вирусного капсида, белковой оболочки, которая защищает геном вируса. Несмотря на десятилетия исследований, самосборка капсидов оставалась загадкой, поскольку не существовало методов измерения кинетики сборки отдельных капсидов. Мы преодолеваем это препятствие, используя метод чувствительной микроскопии, основанный на лазерной интерферометрии. Измерения показывают, что небольшое ядро ​​белков должно сформироваться на вирусной РНК до того, как соберется капсид. Эти результаты могут помочь исследователям разработать стратегии, чтобы остановить сборку патогенных вирусов или построить синтетические наноструктуры.

    Abstract

    Самосборка широко используется биологическими системами для создания функциональных наноструктур, таких как белковые капсиды РНК-вирусов. Но поскольку сборка является коллективным явлением, включающим множество слабо взаимодействующих субъединиц и широкий диапазон временных масштабов, измерения путей сборки были труднодостижимыми. Мы используем микроскопию интерферометрического рассеяния для измерения кинетики сборки отдельных капсидов бактериофага MS2 вокруг РНК MS2. Регистрируя, сколько белков оболочки связывается с каждой из многих отдельных цепей РНК, мы обнаруживаем, что сборка происходит путем нуклеации с последующим монотонным ростом.Наши измерения выявляют пути сборки в количественных деталях, а также показывают их виды отказов. Мы используем эти результаты для критического изучения моделей процесса сборки.

    Термин «самосборка» (1) первоначально был придуман для описания образования вирусного капсида, упорядоченной оболочки белков оболочки, окружающей вирусный геном. Капсиды многих РНК-вирусов могут спонтанно образовываться in vitro из составляющих белков оболочки и цепей РНК (2) в отсутствие гидролиза АТФ или других факторов клетки-хозяина.Эти результаты предполагают, что полный, правильно сформированный капсид представляет собой минимум свободной энергии.

    Минимизация свободной энергии объясняет, почему, но не как собираются определенные структуры капсида. Поскольку сборка является стохастической, есть много причин, по которым этот процесс может пойти наперекосяк (3). Для образования капсида на рис. 1 A , который имеет число триангуляции T, равное 3 (1), 90 химически идентичных димеров белка оболочки должны располагаться в симметрично различных наборах положений. Несмотря на эту структурную сложность, собственные капсиды с Т = 3 собираются с высоким выходом вокруг РНК в соответствующих условиях in vitro (4).Более того, деформированные капсиды, которые образуются в субоптимальных условиях (5), представляют собой лишь крошечное подмножество всех возможных неправильно собранных структур. Недавние теоретические модели предполагают, что взаимодействия между собирающими белками (6) или между белками и РНК (7) смещают пути сборки в сторону правильных капсидов и от неправильно собранных структур.

    Рис. 1.

    Обзор измерения. ( A ) Структурная модель капсида MS2 (PDB ID: 2ms2) показывает его небольшой размер и структуру T = 3.Две конфигурации димера белка оболочки показаны серым и пурпурным. ( B ) Мы вводим раствор несобранных димеров поверх покровного стекла, на котором цепи РНК MS2 связаны ДНК-связями. Когда димеры связываются с РНК, полученные частицы рассеивают свет. Частицы выглядят как темные пятна с ограничением дифракции из-за деструктивной интерференции между рассеянным светом и опорным лучом. ( C ) Мы отслеживаем множество таких точек параллельно. Показано типичное изображение поля зрения, снятое через 126 с после добавления 2-мкм димеров и представляющее в среднем 1000 кадров, снятых со скоростью 1000 кадров в секунду.( D ) Интенсивность каждого пятна пропорциональна количеству связанных белков в каждой частице, и изменения интенсивности как функция времени показывают кинетику сборки каждой частицы. Чем темнее пятно, тем больше его интенсивность. ( D , Top ) Временные ряды изображений для прямоугольной области в C . ( D , Bottom ) График интенсивности для того же пятна с использованием среднего значения за 1000 кадров. Мы обсуждаем взаимосвязь между интенсивностью и количеством связанных белков, а также то, как мы вычисляем интенсивность пятна, в материалах и методах и SI Приложение .

    Однако эксперименты еще не дали ответа даже на основные вопросы о путях сборки и роли РНК, например, начинается ли сборка с небольшого кластера РНК-связанных белков или происходит из большого неупорядоченного агрегата белков и РНК ( 8). Прямые измерения сборки вируса являются сложной задачей, поскольку взаимодействия между субъединицами обычно слабые и зависят от условий раствора (9), так что шкалы времени сборки могут охватывать многие порядки величины: от менее 1 с для начального связывания белков с белками. РНК (10) до многих минут (11) или даже часов (12) для полной сборки ансамбля капсидов.Структурные методы (13) не имеют достаточного временного разрешения для наблюдения за сборкой в ​​таком широком диапазоне временных масштабов, а объемные кинетические измерения (14), которые имеют необходимый динамический диапазон, усредняются по частицам в возможно различных состояниях сборки. Определение оперативных путей требует измерения кинетики сборки отдельных капсидов вокруг вирусной РНК.

    Результаты

    Для проведения таких измерений мы используем интерферометрическую микроскопию рассеяния (15).Мы привязываем РНК-геном бактериофага MS2 — одноцепочечного РНК-вируса с положительным смыслом T = 3, который инфицирует бактерий Escherichia coli — к поверхности функционализированного покровного стекла, используя связи ДНК (16) (рис. 1 B ). ). Затем мы вводим несобранные димеры белка оболочки MS2, суспендированные в буфере с физиологическим pH и соленостью, и мы измеряем изменения в интенсивности рассеяния, когда димеры прикрепляются к поверхностно-привязанной РНК (рис. 1 B и C ). Каждая из этих кривых интенсивности показывает, как количество димеров белка оболочки, связанных с отдельной цепью РНК, изменяется со временем, показывая кинетику сборки этой частицы (рис.1 D ).

    Динамический диапазон этого измерения велик: поскольку рассеяние является упругим, мы можем использовать высокую интенсивность освещения с минимальным риском фотоповреждения, обеспечивая временное разрешение 1 мс. Чтобы одновременно достичь длительности 900 с, мы активно стабилизируем микроскоп во всех трех измерениях, гарантируя, что сигнал от собираемого капсида больше, чем шум из-за дрейфа. Тогда чувствительность ограничивается дробовым шумом. При скользящей средней длительностью 1 с, как показано на рис.1 D , размах колебаний дробового шума соответствует интенсивности 6 димеров белка оболочки.

    Поскольку мы получаем кривые интенсивности для многих собирающихся параллельно частиц, измерение информирует нас о кинетике сборки отдельных частиц, а также о кинетике ансамбля. Ансамбль характеризуется следами, которые сохраняются при низкой интенсивности, затем быстро нарастают, а затем выходят на плато при более высокой интенсивности (рис.2 A и SI Приложение , рис.S1). Когда мы вводим 2 мкМ димеры белка оболочки, мы обнаруживаем, что большинство следов (около 85%) плато с конечной интенсивностью, соответствующей или немного меньшей, чем у полного капсида дикого типа ( SI Приложение , рис. S2), а остальные выходят на плато при значительно более высоких интенсивностях. Напротив, в отсутствие РНК следов мало, и они медленно и непрерывно увеличиваются на протяжении всего эксперимента ( SI, приложение , рис. S3).

    Рис. 2.

    Сборка 2-мкМ димеров белка оболочки вокруг цепей РНК, связанных с поверхностью.( A ) Трассы интенсивности для 12 случайно выбранных частиц из одного эксперимента. Отметки оси x показывают время начала, а отметки оси y показывают конечную интенсивность. Серая полоса указывает диапазон интенсивности, соответствующий капсидам дикого типа. Стрелками показаны 2 следа, соответствующие заросшим частицам. ( B ) Отрицательно окрашенное ПЭМ-изображение частиц, собранных вокруг цепей РНК, привязанных к золотой наночастице (темная область в центре). Мы используем наночастицы в качестве подложки, потому что ПЭМ не может получать изображения через покровное стекло.( C ) Совокупное распределение времени начала всех трасс в эксперименте хорошо согласуется с экспонентой со временем задержки t0, равным 92 с, и характерным временем τ, равным 84 с (см. SI Приложение для результатов подгонки из повторные эксперименты). Погрешности времени начала меньше диаметра окружностей.

    В отдельном контрольном эксперименте мы использовали просвечивающую электронную микроскопию (ПЭМ) для изображения структур, которые собираются вокруг связанной с поверхностью РНК.Изображения показывают, что большинство собранных структур являются собственными капсидами, с несколькими видимыми частичными капсидами и более крупными структурами (Рис. 2 B и SI Приложение , Рис. S4). Таким образом, мы делаем вывод, что капсиды действительно могут собираться вокруг связанных цепей РНК и что следы, которые достигают интенсивности, аналогичной таковой для капсидов дикого типа, представляют собой образование полных или почти полных капсидов.

    Понимая это, мы исследуем, что различия между отдельными следами говорят о путях сборки.Ключевым наблюдением является то, что сборка не синхронна: «время начала», время, в которое интенсивность быстро увеличивается, изменяется от частицы к частице (Рис. 2 A и SI Приложение , Рис. S1). Мы обнаружили, что кумулятивное распределение времени начала t хорошо аппроксимируется экспоненциальной функцией A1 − exp− (t − t0) / τ (рис. 2 C ), где A — значение плато, t0 — задержка перед время старта первой частицы, τ — характерное время. Значения и погрешности подгоночных параметров, оцененные на основе подгонок к повторным измерениям, составляют A = 57 ± 7, t0 = 60 ± 20 с и τ = 100 ± 20 с (стандартное отклонение) ( SI Приложение , рис.S5).

    Задержка t0 до момента первого запуска, вероятно, является результатом диффузии и порогового значения концентрации для сборки. Мы знаем, что такой порог существует, потому что мы не видим сборки при введении 1 мкМ димеров белка оболочки ( SI Приложение , рис. S6). Поэтому мы ожидаем, что сборка будет отложена до тех пор, пока концентрация димера на поверхности покровного стекла не достигнет порогового значения. Поскольку порог составляет от 1 до 2 мкМ, мы можем оценить t0 по характерному времени диффузии димеров из 2 мкМ закачанной жидкости на поверхность.Наша оценка от 30 до 55 с ( SI Приложение , рис. S7) близка к наблюдаемому t0, равному 60 ± 20 с.

    Однако такое широкое распределение времени начала не является результатом распространения. Мы могли бы ожидать роста, ограниченного диффузией, только в том случае, если бы концентрация белка вокруг каждой РНК варьировалась в поле зрения 10 мкм. Но время для диффузии димера 10 мкм составляет всего 1 с, что намного меньше ширины распределения. Кроме того, после начальной задержки, по нашим оценкам, около 1000 димеров белка оболочки находятся в пределах 1 мкм от каждой РНК.При этой концентрации пул белков оболочки существенно не истощается при сборке, и колебания концентрации незначительны. Мы пришли к выводу, что наблюдаемые следы интенсивности не являются результатом изменения концентрации белка.

    Взятые вместе, эти результаты исключают пути сборки, которые начинаются с агрегации, ограниченной диффузией, и четко указывают на те, которые включают зародышеобразование — процесс, в котором первоначально нестабильный кластер белков, называемый «ядром», должен вырасти больше, чем критический размер, прежде чем расти. продолжается (17).Ниже этого размера растущий зародыш становится все более нестабильным, так что формирование критического зародыша соответствует преодолению барьера свободной энергии (18). Широкое распределение времени начала, которое мы измеряем, свидетельствует о таком барьере и согласуется с зародышевым процессом. То, что форма распределения хорошо описывается одной экспонентой, предполагает, что существует единственный, четко определенный барьер зародышеобразования с временем зародышеобразования τ (см. Приложение SI , чтобы узнать, как мы исключаем другие барьеры, связанные с возможными неспецифическими взаимодействиями. между РНК и поверхностью).

    Колебания интенсивности раскрывают дополнительную информацию о событии нуклеации. Перед временем начала флуктуации соответствуют ожидаемым от дробового шума, который, как отмечалось выше, соответствует 6 димерам при усреднении за 1 с. Это измерение косвенно ограничивает критический размер ядра: если мы предположим, что белки только временно связываются с РНК до нуклеации, то подкритические ядра размером более 6 димеров не выживают дольше 1 секунды. Однако, если небольшое количество белков постоянно связывается с РНК, то эти белки могут быть не видны из-за длительного дрейфа в измерениях.

    Из-за небольшого видимого размера критического зародыша, большинство димеров в капсиде должны добавляться во время последующей фазы роста. Мы характеризуем рост, исследуя рост интенсивности каждого следа после зарождения. Мы обнаружили, что «время роста», время, необходимое для того, чтобы частица достигла размера полного капсида после ее зарождения, варьируется от частицы к частице в диапазоне от 30 до более 200 с (рис. 2 A и SI. Приложение , рис. S1). Из частиц, которые превращаются в полноценный капсид, одни растут с постоянной скоростью, другие медленно по мере приближения к завершению, а третьи содержат промежуточные паузы продолжительностью до 25 с (рис.2 A и SI Приложение , рис. S1). Несмотря на эти различия, по существу все трассы монотонны, с небольшими заметными этапами разборки или без них.

    Эти наблюдения предоставляют количественную информацию о кинетике роста капсида, а также раскрывают качественные особенности путей роста. Время роста на 4 порядка больше, чем временной масштаб, необходимый для того, чтобы димеры капсида столкнулись с РНК путем диффузии ( SI Приложение ), что позволяет предположить, что только небольшая часть этих столкновений приводит к росту.И хотя широкое распределение времени роста и различные формы следов предполагают множество различных путей роста, отсутствие какой-либо наблюдаемой разборки предполагает, что система избегает путей, которые включают массовый сброс связанных белков.

    Кроме того, мы можем почерпнуть информацию о типах отказов в процессе сборки по следам частиц, которые вырастают значительно крупнее капсида. Поскольку разные пути сборки могут давать сбой по-разному, устранение этих режимов сбоя дает ценную информацию об оперативных путях.Мы обнаружили, что большинство следов заросших частиц останавливаются с интенсивностью, соответствующей интенсивности капсида, прежде чем снова подняться до более высокого значения плато (Рис. 2 A и SI Приложение , Рис. S1). ПЭМ-изображения частиц, собранных вокруг непривязанной РНК, показывают, что большинство разросшихся структур состоят из капсида, прикрепленного ко второму частичному или полному капсиду ( SI Приложение , рис. S8). Эти наблюдения предполагают, что разросшиеся частицы являются результатом второго события нуклеации, которое происходит до того, как растущий капсид полностью упаковывает РНК.

    Чтобы проверить эту гипотезу, мы варьируем кинетику сборки, регулируя концентрацию белка оболочки (Рис. 3 A и SI Приложение , Рис. S9 и S10). Мы обнаружили, что время нуклеации уменьшается с увеличением концентрации белка, со 160 ± 40 с при 1,5 мкМ димеров до 11 ± 5 с при 4 мкМ (стандартное отклонение) (рис. 3 B и SI, приложение , рис. S5). . Это уменьшение сопровождается увеличением доли заросших частиц от примерно 5% при димерах 1,5 мкМ до более 40% при 4 мкМ (рис.3 С ). ПЭМ-изображения несвязанных частиц показывают размеры, которые примерно соответствуют конечной интенсивности, наблюдаемой на трассах, при этом многие из заросших частиц состоят из сгустков частичных или почти полных капсидов (рис. 3 D и SI Приложение , рис. S8. ).

    Рис. 3.

    Кинетика сборки при различных концентрациях белка. ( A ) Следы интенсивности для 10 случайно выбранных частиц при 1,5 мкМ и 4 мкМ димерах белка оболочки. ( B ) Кумулятивные распределения времени начала показывают, что скорость зародышеобразования увеличивается с концентрацией белка.Данные аппроксимируются экспонентой с характерным временем зародышеобразования τ, как описано выше. Длина каждой горизонтальной полосы представляет собой погрешность каждого измерения времени. ( C ) Кумулятивные распределения конечных интенсивностей показывают, что доля заросших частиц увеличивается с концентрацией белка. Длина каждой горизонтальной полосы — это стандартное отклонение, рассчитанное на основе последних 50 с каждой кривой. ( D ) ПЭМ-изображения частиц, собранных вокруг непривязанной РНК.При 1,5 мкМ белка ( Left ) большинство частиц, по-видимому, являются капсидами. При 4 мкМ белка ( Right ) многие частицы представляют собой кластеры частичных капсидов.

    Время роста также уменьшается с увеличением концентрации белка, но медленнее, чем время зародышеобразования (рис. 4 A ). Таким образом, мы заключаем, что РНК, которая способствует зародышеобразованию при низкой концентрации белка, создает конкуренцию между зародышеобразованием и ростом, что может привести к разрастанию структур при более высокой концентрации, как показано на рис.4 В . Этот путь обеспечивает возможное объяснение структур «монстр» (5) и «мультиплет» (19), наблюдаемых с другими РНК-вирусами.

    Рис. 4.

    Относительные шкалы времени зарождения и роста и предполагаемые пути сборки. ( A ) Измерено время зародышеобразования (τnuc) и среднее время роста (τgrow) при различных концентрациях белка. Планки погрешностей представляют собой стандартное отклонение от 3 повторных экспериментов. ( B ) Рисунок предполагаемых путей сборки. При низкой концентрации белка τnuc больше, чем τgrow, и ядро ​​белков оболочки формируется на РНК, а затем превращается в правильный капсид.При умеренной концентрации белка τnuc сравнимо с τgrow, и второе ядро ​​может сформироваться на РНК до того, как первое завершит рост, что приводит к разрастанию структуры, состоящей из почти полного капсида, прикрепленного к частичному капсиду. При высокой концентрации белка τnuc меньше, чем τgrow, и могут образовываться и расти несколько ядер, что приводит к разрастанию структуры, состоящей из множества частичных капсидов. Примеры изображений ПЭМ конечных точек каждого пути показаны в позиции Справа .

    Обсуждение

    Наши измерения на отдельных капсидах MS2 позволяют нам сделать вывод об особенностях путей сборки, которые не видны при объемных измерениях, таких как наличие барьера зародышеобразования или отсутствие существенных этапов разборки. Мы не утверждаем, что эти особенности должны присутствовать при сборке in vivo; действительно, мы можем делать такие выводы только потому, что проводим наши измерения вне тесноты клетки. Кроме того, эти функции могут отличаться для других вирусов и других экспериментальных условий.Тем не менее, измерения in vitro, выполненные с использованием ряда вирусов и экспериментальных условий, оказались критически важными для понимания физики самосборки вирусов (20).

    Будь то in vitro или in vivo, белки оболочки и нити РНК многих вирусов T = 3 способны совершить замечательный подвиг: спонтанную самосборку в нетривиальную структуру с высоким выходом. Тот факт, что этот процесс трудно воспроизвести в синтетических системах, показывает, что физика все еще недостаточно изучена.Поэтому мы исследуем наши результаты в контексте общих физических моделей самосборки вирусов. Существует множество таких моделей, которые резко различаются по роли, которую играет РНК. Сравнивая наши экспериментальные результаты с предсказаниями таких моделей, мы стремимся определить, какие физические механизмы согласуются с нашими данными и что можно сделать, чтобы прийти к модели сборки, которая количественно согласуется с экспериментом.

    Сначала отметим, что наши результаты предостерегают от построения моделей сборки, основанных в первую очередь на статических измерениях, таких как структурные данные или равновесное сродство связывания.Такие модели подтверждают, что сборка детерминированно следует из образования специфических контактов белок-белок (13) или взаимодействий белок-РНК с высоким сродством (21). Напротив, описанные здесь сложные пути сборки и режимы отказа требуют моделей, которые отражают высокодинамичные и коллективные процессы.

    Модели зарождения и роста учитывают коллективный характер сборки. В моделях зародышеобразования пустых (22) и белковых капсидов (23), которые собираются без РНК, критическое ядро ​​формируется в массе.Но недавняя вычислительная модель, которая включает РНК как гомогенный линейный полимер (24), исследует 2 дополнительных механизма зародышеобразования. В одном ядро ​​формируется из небольшого кластера белков, адсорбированных на голой цепи РНК. С другой стороны, он образуется из белков, которые адсорбируются и агрегируются по всей цепи.

    Наши наблюдения показывают, что зародышеобразование происходит непосредственно на цепи РНК, а не в целом или в совокупности. То, что сборка зарождается, подтверждается широким распределением времени до сборки, как обсуждается в Results .Если бы нуклеация происходила в массе, можно было бы ожидать большого количества пустых капсидов, но гель-электрофорез показывает, что продукты сборки содержат РНК ( SI, приложение , рис. S11). Если бы зарождение происходило в неупорядоченной совокупности белков на РНК, мы могли бы ожидать, что следы интенсивности будут выше уровня шума во время процесса агрегации, но мы не видим такого увеличения. Таким образом, мы заключаем, что зародышеобразование происходит на голых или почти голых частях РНК.

    В то время как дифракционный предел не позволяет нам напрямую измерить, где формируется ядро ​​на цепи РНК, наши результаты действительно позволяют нам проверить давнее предположение о задействованных последовательностях.В MS2 белки оболочки связываются с высокой аффинностью (Kd порядка 1 нМ) с последовательностью из 19 оснований РНК, называемой «оператором трансляции» (10), и с гораздо более низкой аффинностью (от 10 до 1000 нМ) с другими 19 основаниями. последовательности, предполагая, что этот оператор действует как сайт зародышеобразования (25). Однако наше наблюдение за порогом микромолярной концентрации для сборки предполагает, что нуклеация не зависит от связывания наномолярного сродства между белками оболочки и оператором трансляции, но, вероятно, включает другие, более слабые взаимодействия.То, что в предыдущем исследовании сообщалось о сборке при 10-кратно меньших концентрациях белка (12), не противоречит нашему наблюдаемому порогу. Вместо этого разница может отражать другой используемый буфер сборки, как описано в приложении SI .

    Точно так же, хотя мы не можем определить высоту зародышевого барьера или размер критического зародыша непосредственно из наших измерений, мы можем установить ограничение на размер зародыша по флуктуациям интенсивности, как описано в Результатах .Из-за шума в наших измерениях и конечного времени усреднения этот предел представляет собой комбинацию размера и срока службы. В частности, мы обнаружили, что подкритические кластеры должны быть либо очень маленькими (менее 6 димеров), либо очень короткоживущими (меньше, чем время усреднения, которое составляет 1 с). Если небольшое количество белков постоянно связывается с РНК, они также могут способствовать формированию ядра. В любом случае эти ограничения размера и срока службы обеспечивают конкретные количественные ограничения на модели сборки.

    Очевидный малый размер критического зародыша поднимает вопрос о том, как процесс роста обеспечивает высокие урожаи.В упрощенных моделях капсидов с Т = 1, где все конфигурации белков идентичны (26), образования ядра может быть достаточно, чтобы гарантировать, что рост приводит к правильной структуре. Это не обязательно для капсидов с Т = 3, где существуют неэквивалентные конфигурации белков и, следовательно, гораздо больше возможных неправильно собранных структур, в том числе с неправильной локальной кривизной (27). Наше наблюдение монотонного роста после нуклеации предполагает, что поступающие белки легко принимают конфигурации внутри растущего капсида, которые обеспечивают правильную кривизну.Даже при высокой концентрации белка, когда неправильно собранные частицы состоят из нескольких частичных или полных капсидов, кривизна этих капсидов не отличается от кривизны отдельных, хорошо сформированных капсидов.

    Одно из возможных объяснений состоит в том, что взаимодействия между собирающими белками смещают пути к правильным капсидам. Недавняя модель, основанная на теории непрерывной эластичности (28), предполагает, что белки оболочки принимают правильные конфигурации в капсиде по мере его роста, чтобы минимизировать упругое напряжение.Эта модель предсказывает, что количество белков в растущем капсиде должно монотонно увеличиваться со временем, что согласуется с нашими измерениями фазы роста. Для дальнейшего тестирования этой модели мутантные белки оболочки с различными взаимодействиями могут быть использованы для исследования роли упругого стресса в контроле путей роста.

    Другое объяснение состоит в том, что взаимодействия белок-РНК направляют пути роста. Некоторые модели предполагают, что рост капсида определяется общими электростатическими взаимодействиями между белками оболочки и РНК (29).Однако более поздняя модель предполагает, что «множественные диспергированные, специфические взаимодействия» (ref. 7, p. 74) между белками и битами вторичной структуры РНК направляют поступающие белки в правильные локальные конфигурации. Недавние эксперименты с MS2 — включая биохимические (30), структурные (31) и объемные кинетические (12) измерения — предоставляют косвенные доказательства того, что такие структуры участвуют в сборке капсида, но не решают, как они влияют на процесс роста. Поскольку наш метод совместим с цепями РНК произвольной последовательности и буферами сборки произвольной ионной силы, будущие исследования могут проверить эти модели, изменяя отдельные структуры РНК или силу электростатических взаимодействий, а затем измеряя изменения в путях роста.

    Conclusions

    Наши измерения порога нуклеации, времени нуклеации, докритических флуктуаций и времени роста в MS2 обеспечивают важные количественные ограничения на моделирование путей сборки (24). В результате структуры критического ядра и последующих промежуточных состояний, которые долгое время ускользали от прямых методов визуализации, теперь могут быть выведены путем количественного сравнения наших измерений и подобных имитаций. Понимание путей сборки вирусных капсидов на этом уровне детализации может дать информацию о стратегиях блокирования сборки патогенных вирусов (32) или для создания синтетических капсидов (33).

    Наконец, хотя наши наблюдения специфичны для путей сборки in vitro, они предоставляют физическую гипотезу репликации вируса in vivo. Поскольку РНК внутри капсида не может транслироваться или реплицироваться, РНК-вирусы должны задерживать сборку капсида и упаковку генома до тех пор, пока не будет произведено множество копий их белков и генома. Путь сборки с концентрационным порогом для зародышеобразования — такой, который мы наблюдаем — обеспечил бы такую ​​задержку. Более того, эта задержка позволит концентрации вновь реплицированной вирусной РНК увеличиться по сравнению с фоновой концентрацией цепей РНК хозяина, увеличивая вероятность того, что вирусная РНК упакована.

    Материалы и методы

    Рост MS2 и очистка его белка оболочки и РНК.

    Мы выращиваем MS2 дикого типа (подарок Питера Стокли из Университета Лидса, Лидс, Великобритания), заражая жидкие культуры штамма E. coli C3000 (также подарок Питера Стокли) и очищая потомство вирусов. протоколы Штрауса и Зиншеймера (34). Мы очищаем димеры белка оболочки (2 × 13,7 = 27,4 кДа) из вирусных частиц с помощью метода холодной уксусной кислоты, описанного Сугиямой, Хебертом и Хартманом (2).Мы очищаем РНК MS2 (1,1 МДа) из недавно выращенных вирусных частиц с помощью набора для экстракции РНК (RNeasy; Qiagen). Наша процедура оценки концентрации и чистоты этих материалов описана в приложении SI , рис. S11 и S12.

    Микроскоп.

    Наш микроскоп аналогичен микроскопу, описанному Ortega-Arroyo et al. (35) и настроен в широкопольном режиме без сканирования луча. Подробности приведены в приложении SI , рис. S13. Мы используем свет с длиной волны 450 нм и интенсивностью освещения ∼3 кВт / см2.Контрольные эксперименты при различной интенсивности освещения показывают, что используемая интенсивность не влияет на кинетику сборки ( SI Приложение , рис. S14). Общее поле зрения составляет 140 пикселей × 140 пикселей (9,8 мкм × 9,8 мкм). Изображения записываются с частотой 1000 Гц. Для борьбы с механическим дрейфом при длительности измерения 900 с положение покровного стекла относительно объектива активно стабилизируется до нескольких нанометров во всех трех измерениях с помощью пьезоэлектрических приводов, как подробно описано в приложении SI .

    Интенсивность изображения.

    Собирающиеся частицы выглядят как темные дифракционные пятна. Интенсивность каждого пятна приблизительно линейно пропорциональна количеству белков, связанных с цепью РНК. Интенсивность пятна равна I = Ir + Is + 2IrIscosϕrs, где Ir — интенсивность отраженной волны, Is — интенсивность рассеянной волны, а ϕrs — разность фаз между ними. Членом Is можно пренебречь, поскольку рассеянный свет тусклый по сравнению с отраженным светом, поэтому нормированная интенсивность Inorm = I / Ir − 1 пропорциональна общей поляризуемости собирающейся частицы (15), которая приблизительно равна сумме белковый компонент и компонент РНК.Ранее мы показали, что эта линейная суперпозиция является хорошим приближением для частиц бактериофага λ, которые состоят из белкового капсида, окружающего одну молекулу плотно упакованной ДНК (36). Здесь, поскольку компонент РНК статичен, он является частью фона и вычитается нашей процедурой обработки изображений, которая описана в приложении SI . В результате нормализованная интенсивность линейно пропорциональна количеству белков в собирающейся частице, что согласуется с другими исследованиями мультипротеиновых комплексов (15).

    Калибровка микроскопа.

    Мы калибруем измерения интенсивности с помощью микроскопа, используя 2 частицы известной массы: нити РНК MS2 и частицы вируса MS2 дикого типа ( SI Приложение , рис. S2). Мы делаем вывод о распределении интенсивности, соответствующем капсидам дикого типа, свертывая распределение интенсивности частиц дикого типа с отрицательным из распределения интенсивности РНК. Мы используем это предполагаемое распределение интенсивности для оценки интенсивности полных капсидов, которые собираются в наших экспериментах, как показано серыми полосами на рис.2 A и 3 A . Распределение намного шире, чем ожидаемое массовое распределение для капсидов дикого типа, которые довольно монодисперсны. Таким образом, ширина распределения отражает неопределенность наших измерений.

    Функционализация покровного стекла и связывание РНК.

    Мы адаптируем протоколы, описанные Джу и Ха (37), для покрытия покровных стекол слоем молекул полиэтиленгликоля (ПЭГ), около 1% из которых функционализированы цепочкой ДНК из 20 оснований.Последовательность поверхностно-связанной ДНК — GGTTGGTTGGTTGGTTGGTT. Мы дополнительно украшаем покровные стекла 30-нанометровыми частицами золота, пассивированными ПЭГ, которые служат в качестве индикаторов для активной стабилизации. Непосредственно перед каждым экспериментом мы инкубировали покровные стекла с раствором детергента, содержащим 0,2% твин-20, чтобы пассивировать любые незащищенные участки на покрытии PEG. Затем мы привязываем цепи РНК MS2 к покровным стеклам, используя линкерную цепь ДНК из 60 оснований: 40 оснований на 5′-конце линкера комплементарны 40 основаниям на 5′-конце РНК, а оставшиеся 20 оснований являются комплементарен последовательности поверхностно-связанной ДНК ( SI Приложение , рис.S15). Последовательность линкера CGACAGGAAGTTGAGCAGGACCCCGAAAGGGGTCCCACCCAACCAACCAACCAACCAACC. Мы гибридизуем РНК с линкером путем термического отжига в буфере для гибридизации (50 мМ Tris⋅HCl, pH 7,0; 200 мМ NaCl; 1 мМ ЭДТА), а затем позволяем полученным комплексам РНК-ДНК связываться с функционализированной ДНК поверхностью при комнатной температуре. температура. Связывание с поверхностью является высокоспецифичным ( SI, приложение , рис. S16). Подробная информация об этапах функционализации, термического отжига и поверхностного связывания приведена в приложении SI .

    Эксперимент по кинетике сборки.

    Мы вводим димеры белков оболочки в цепочки РНК, связанные с поверхностью, с помощью самодельных проточных кювет. Крыша и стенки ячеек сделаны из акрила, а пол состоит из описанного выше покровного стекла, функционализированного РНК. Подробная информация о конструкции проточных ячеек приведена в приложении SI , рис. S17. Для проведения эксперимента по сборке мы промываем проточную кювету буфером для сборки (42 мМ Tris⋅HCl, pH 7,5; 84 мМ NaCl; 3 мМ уксусная кислота; 1 мМ EDTA), начинаем запись фильма с помощью микроскопа интерферометрического рассеяния, а затем введите 10 мкл указанной концентрации несобранных димеров в сборочный буфер с помощью шприцевого насоса.Вводимый объем примерно в 3 раза больше, чем объем камеры для пробы. Инъекция начинается с 4 с в фильм и продолжается 20 с. Оценка того, сколько времени требуется инъецированным димерам, чтобы достичь связанных с поверхностью цепей РНК, описана в приложении SI , рис. S7. Мы проводим 3 повторных эксперимента для всех измерений микроскопии интерферометрического рассеяния с 1,5-, 2- и 4-мкМ димерами белка оболочки. Данные этих повторов показаны на Рис. 4 A и SI Приложение , Рис.S5. Мы также проводим контрольный эксперимент, в котором мы привязываем только цепь ДНК-линкера к поверхности покровного стекла без РНК, а затем выполняем измерение с помощью микроскопии интерферометрического рассеяния с димерами 2 мкМ. Результаты этого контроля обсуждаются в Приложении SI и показаны в Приложении SI , рис. S3.

    Анализ следов интенсивности.

    Время начала для каждой кривой определяется как время, когда интенсивность достигает 0,001. Чтобы определить время роста, мы сначала выполняем линейную аппроксимацию методом наименьших квадратов для части каждой кривой, которая находится между временем начала и временем, когда интенсивность впервые достигает значения полного капсида.Затем мы оцениваем время, необходимое для выращивания полного капсида (связывания 90 димеров), аппроксимируя скорость роста как наклон линейной аппроксимации. Подробности этого анализа описаны в Приложении SI .

    ТЕМ.

    Мы используем отрицательно окрашенный ПЭМ для изображения белковых структур, которые собираются вокруг РНК, которая либо привязана к функционализированной наночастице золота (как на Рис. 2 B и SI Приложение , Рис. S4), либо свободна в растворе (как на рис.3 D и SI Приложение , рис.S8). Метод, используемый для функционализации поверхностей золотых частиц, аналогичен методу, используемому для покровных стекол, и подробно описан в Приложении SI . Реакцию сборки проводят в буфере для сборки путем смешивания указанной микромолярной концентрации димеров белка оболочки либо с 0,2 нМ РНК-меченых частиц золота, либо с 10 нМ свободной РНК. Эту смесь оставляют на 10 минут при комнатной температуре, а затем добавляют к протравленной плазмой, покрытой углеродом ПЭМ-оболочке (Ted Pella), окрашивают раствором красителя метиламина вольфрамата (Nanoprobes) и визуализируют на ТЕМ Tecnai F20 (FEI). работал на 120 кВ.Дополнительные сведения о подготовке образцов для ПЭМ и визуализации приведены в приложении SI .

    Доступность данных.

    Все представленные данные могут быть получены у соответствующего автора по обоснованному запросу.

    Благодарности

    Мы благодарим Эми Баркер и Питера Стокли из Университета Лидса за начальные запасы бактериофага MS2 и клеток E. coli . Мы благодарим Филипа Кукуру, Марека Пилиарика, Вахида Сандогдара, Уильяма Джейкобса и Майкла Бреннера за полезные обсуждения.Эта работа поддержана Гарвардским центром материаловедения и инженерии в рамках гранта DMR-1420570 Национального научного фонда (NSF); стипендия для аспирантов NSF по гранту DGE-1144152; Национальный институт общих медицинских наук Национальных институтов здравоохранения по гранту K99GM127751; Центр математического и статистического анализа биологии NSF-Simons при Гарвардском университете в рамках гранта 1764269; и Гарвардская инициатива в области количественной биологии. Эта работа была частично выполнена в Гарвардском центре наномасштабных систем при поддержке NSF Grant 1541959.

    Сноски

    • Вклад авторов: R.F.G. и A.M.G. спроектировал экспериментальную установку, провел эксперименты и проанализировал данные; А.М.Г., Р.Ф.Г. и В.Н.М. написал статью; и В.Н.М. предложил изучить самосборку вируса с помощью интерферометрической рассеивающей микроскопии и руководил проектом.

    • Авторы заявляют об отсутствии конкурирующей заинтересованности.

    • Эта статья представляет собой прямое представление PNAS.

    • См. Комментарий на стр. 22420.

    • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.1

    • 3116/-/DCSupplemental.

    • Copyright © 2019 Автор (ы). Опубликовано PNAS.

    Сборка de novo и этапирование корейского генома человека

    Статистические методы не использовались для предварительного определения размера выборки. Эксперименты не были рандомизированы, и исследователи не были закрыты для распределения во время экспериментов и оценки результатов.

    Клеточная линия AK1

    Иммортализованная линия лимфобластоидных клеток была получена от индивидуума AK1 посредством трансформации мононуклеарных клеток вирусом Эпштейна-Барра (Seoul Clinical Laboratories Inc.). Полное тестирование на патогены проводилось и поддерживалось в помещении, свободном от микоплазм. Линию лимфобластоидных клеток AK1 культивировали в среде RPMI 1640, содержащей 15% FBS, при 37 ° C в увлажненной среде с 5% CO 2 . Номер разрешения C-0806-023-246 для лица AK1 был присвоен на основании рекомендаций Институционального наблюдательного совета Сеульского национального университета.

    Создание данных PacBio

    Геномную ДНК экстрагировали из клеток AK1 с использованием набора для клеток Gentra Puregene Cell Kit (Qiagen). Подготовка библиотеки PacBio с большими вставками проводилась в соответствии с протоколами, рекомендованными Pacific Biosciences. Вкратце, всего 60 мкг геномной ДНК AK1 было разрезано до размера мишени ~ 20 т.п.н. с использованием Covaris g-TUBEs (Covaris). При каждом сдвиге обрабатывали 10 мкг входящей ДНК, и в общей сложности выполняли 6 сдвигов. Разрезанную геномную ДНК исследовали с помощью чипа Agilent 2100 Bioanalyzer DNA12000 Chip (Agilent Technologies Inc.) для распределения по размеру и подверглись репарации повреждений ДНК / репарации концов, лигированию адаптера тупого конца с последующим расщеплением экзонуклеазой. Очищенные продукты расщепления загружали на предварительно отлитую 0,6% агарозу для отбора размером 7–50 т.п.н. с использованием системы выбора размера BluePippin (Sage Science), а полученные продукты библиотеки с отобранным размером очищали с использованием 0,5-кратного предварительно промытого Agencourt AMPure XP. бусины (Beckman Coulter). Конечные библиотеки были исследованы с помощью чипа Agilent 2100 Bioanalyzer DNA12000 на предмет распределения по размерам, а концентрация библиотеки была определена с помощью Qubit 2.0 Флуорометр (Life Technologies). Мы секвенировали с помощью прибора PacBio RSII со связыванием полимеразы P6 и химическими наборами C4 (P6C4). Всего использовали 380 клеток SMRT, чтобы получить данные о 101-кратной полногеномной последовательности.

    Пробоподготовка для BioNano Genomics

    Клетки AK1 осаждали и промывали PBS; конечный осадок клеток ресуспендировали в буфере для суспензии клеток с использованием набора CHEF для геномной ДНК млекопитающих (Bio-Rad). Затем клетки помещали в легкоплавкую агарозу CleanCut (Bio-Rad) и распределяли тонким слоем на специальной подставке (в разработке в BioNano Genomics).Клетки лизировали с использованием буфера для лизиса IrysPrep (BioNano Genomics), обрабатывали протеазой Puregene Proteinase K (Qiagen) с последующей кратковременной промывкой в ​​Tris с 50 мМ EDTA и затем отмывкой в ​​Tris с 1 мМ EDTA перед обработкой РНКазы Puregene RNase (Qiagen) . Затем ДНК уравновешивали в Трис с 50 мМ ЭДТА и инкубировали в течение ночи при 4 ° C перед обширной промывкой в ​​Трис с 0,1 мМ ЭДТА с последующим уравновешиванием в NEBuffer 3 (New England BioLabs) при 1-кратной концентрации. Очищенную ДНК в тонкослойной агарозе метили в соответствии с протоколом набора реагентов IrysPrep с адаптациями для метки в агарозе.Вкратце, 1,25 мкг ДНК расщепляли 0,7 ед. Нуклеазой Nt.BspQI на микролитр реакционного объема в NEBuffer 3 (New England BioLabs) в течение 130 мин при 37 ° C, затем промывали буфером TE Low EDTA (Affymetrix), pH 8.0, с последующим уравновешиванием 1 × реакционным буфером ThermoPol (New England BioLabs). Затем расщепленную ником ДНК инкубировали в течение 70 мин при 50 ° C с использованием смеси для маркировки IrysPrep (BioNano Genomics) и ДНК-полимеразы Taq (New England BioLabs) до конечной концентрации 0,4 Ед мкл -1 .Меченную ником ДНК инкубировали в течение 40 мин при 37 ° C, используя смесь IrysPrep Repair (BioNano Genomics) и Taq ДНК-лигазу (New England BioLabs) в конечной концентрации 1 ед. Мкл -1 . Меченую репарированную ДНК затем извлекали из тонкослойной агарозы путем переваривания с помощью GELase и контрастировали с помощью окрашивания ДНК IrysPrep (BioNano Genomics) перед сбором данных в системе Irys. Процесс спасения хрупких сайтов защищает хрупкие сайты за счет снижения температуры реакции мечения и сводит к минимуму силы сдвига, удерживая ДНК в агарозе до тех пор, пока трещины не будут заживлены.В этом случае ломаются только ближайшие пары узлов с противоположной нитью.

    Подготовка библиотеки для секвенирования с использованием платформы GemCode

    Библиотеки для индексации образцов и разделения штрих-кодов были подготовлены с использованием GemCode Gel Bead and Library Kit (10 × Genomics) 4 . Секвенирование проводили с помощью Illumina Hiseq2500 для создания связанных считываний.

    Генерация данных Illumina

    Библиотеки были созданы с использованием протоколов без ПЦР. гДНК подвергали сдвигу дважды, используя Covaris S2, с условиями цикла: рабочий цикл 10%, циклы / пакет 200 и время 100 с.Разрезанная ДНК была обработана с использованием протокола Illumina TruSeq DNA PCR-Free LT Library Kit для создания вставок 550 п.н., которые включают репарацию концов, выбор размера гранул SPRI, A-хвост и лигирование Y-адаптера. Концентрацию библиотеки измеряли с помощью кПЦР и загружали на приборы HiSeq X Ten (PE-150) для получения 72-кратного покрытия последовательностей.

    Препарат ДНК из клонов ВАС

    Всего 32 026 клонов ВАС были отобраны из 252 384-луночных планшетов и повторно помещены в 96-луночные планшеты.Клоны выращивали в течение ночи, и культуры использовали для приготовления двух дополнительных повторов для двух 384-луночных планшетов, которые хранили при -80 ° C в среде LB, содержащей 20% глицерина. В общей сложности 32 026 культур клонов с ростом при OD от 0,6 до 1,0 были объединены, осаждены и ДНК экстрагирована с использованием стандартного метода щелочного лизиса. В этой процедуре осадок клеток ресуспендировали в 150 мкл буфера P1 Qiagen с РНКазой и лизировали с помощью 150 мкл 0,2 М NaOH, 1% раствора SDS в течение 5 мин.Лизис нейтрализовали добавлением 150 мкл 3 М ацетата натрия, pH 4,8. Нейтрализованный лизат инкубировали на льду в течение 30 минут, и ДНК собирали центрифугированием в течение 15 минут при 15,7 г при 4 ° C, концентрировали стандартным осаждением этанолом и ресуспендировали в 25 мкл 10 мМ трис-HCl, pH 8,5.

    PacBio секвенирование клонов ВАС

    ДНК из примерно 150 клонов ВАС с примерно эквимолярной концентрацией объединяли в единый пул. Всего было разрезано 10 мкг ДНК каждого пула и отобраны фрагменты с размером вставки от 10 до 15 т.п.н.Две библиотеки были приготовлены из объединенной ДНК с использованием набора для подготовки библиотеки PacBio SMRTbell v1.0. Количественную оценку библиотек проводили с использованием флуориметра Qubit 2.0, и каждую библиотеку секвенировали с использованием двух клеток SMRT с химическим составом P6C4.

    Illumina секвенирование клонов ВАС

    ДНК из примерно 290 клонов ВАС с примерно эквимолярной концентрацией объединяли в единый пул ВАС. Один нанограмм ДНК из каждого пула был переварен, и были отобраны фрагменты с размером вставки от 500 до 550 п.н.В общей сложности 109 библиотек были приготовлены из объединенной ДНК с использованием набора для подготовки образцов ДНК Nextera XT, совместимого с Illumina, и секвенированы с помощью HiSeq2500.

    Подготовка образца для секвенирования РНК

    Мы экстрагировали РНК из ткани с помощью RNAiso Plus (Takara Bio) с последующей очисткой с помощью RNeasy MinElute (Qiagen). РНК оценивали на качество и количественно определяли с помощью RNA 6000 Nano LabChip на 2100 Bioanalyzer (Agilent). Библиотеки секвенирования РНК (RNA-seq) получали, как описано ранее 20 .Библиотеку РНК секвенировали с помощью Illumina TruSeq SBS Kit v3 на секвенаторе HiSeq 2000 (Illumina) для получения считываний парных концов длиной 100 пар оснований. Анализ изображения и базовый вызов выполнялись с использованием конвейера Illumina с настройками по умолчанию.

    Подготовка образцов для секвенирования изоформ

    Суммарную РНК, экстрагированную из клеток AK1 с числом целостности РНК (RIN)> 8,0, использовали для подготовки библиотеки. Библиотека была создана в соответствии с Руководством по подготовке образцов синтеза кДНК Clontech SMARTer-PCR.Библиотеки 1–2 т.п.н., 2–3 т.п.н., 3–6 т.п.н. и> 5 т.п.н. были отобраны с помощью Sage, адаптеры SMRTbell очищенные, с репарированными концами и с тупым концом были лигированы. Распределение фрагментов по размеру подтверждали на чипе Bioanalyzer HS (Agilent) и количественно определяли на флуорометре Qubit (Life Technologies). Распределение размеров фрагментов проверяли на чипе Bioanalyzer HS (Agilent) и количественно определяли на флуорометре Qubit (Life Technologies). Секвенирование проводили на приборе PacBio RSII с использованием P6C4.

    Долгое чтение PacBio

    de novo сборка

    При сборке с FALCON v0 использовалось около 31 миллиона субпотоков.3.0 (ссылка 21) с заданным параметром length_cutoff 10 кб для начального сопоставления для построения предварительно собранных чтений (preads), и preads более 15 kb были использованы (length_cutoff_pr) для максимизации собранного контига N50 (расширенные данные рис. 2). Первичные и связанные контиги полировали с помощью Quiver 5 .

    Поколение геномной карты BioNano Genomics

    Оптические карты de novo были собраны в геномные карты с использованием программного обеспечения ассемблера BioNano (Irys System, BioNano Genomics). Для поиска возможных перекрытий использовали одиночные молекулы длиной более 150 т.п.н. с по меньшей мере 8 флуоресцентными метками ( P <1 × 10 -10 ).Затем эти карты были построены до консенсусных карт путем их рекурсивного уточнения и расширения путем сопоставления отдельных молекул ( P <1 × 10 -5 ). Консенсусные карты сравнивали и объединяли в геномные карты, когда образцы совпадали ( P <1 × 10 -10 ). После этого был получен второй набор оптических карт, которые сгенерировали в карты генома с теми же критериями.

    Редактирование Contig и гибридная сборка

    Первичные контиги были in silico, расщеплены в cmaps, и их сравнивали с картами генома для каркаса.Строительные леса были визуализированы и выполнены с помощью Irys Viewer. При возникновении конфликта контиги редактировались под руководством карты генома.

    Усовершенствования сборки

    Парные считывания с платформы Illumina были выровнены по сборке с помощью bwa 22 mem с последующим удалением дубликатов с помощью инструментов Picard 23 . Коррекция базовой пары сборки была выполнена с использованием Pilon 24 . Pilon в основном исправлял одиночные вставки и делеции в областях, обогащенных гомополимером.Контиги или каркасы короче 10 т.п.н. были исключены из общего анализа, чтобы избежать результатов ложной неправильной сборки.

    Измерение точности каркаса с клонами ВАС

    Точность каркаса сборки AK1 оценивали с использованием библиотеки ВАС AK1 1 . Концевые последовательности BAC AK1 (BES) были сопоставлены со сборками GRCh47, GRCh48 и AK1 с использованием BWA. Размещение BES было классифицировано по выравниванию, ориентации и разделению BES по отношению к сборке. Размещение BES было определено как согласованное: (1) если размещение BES было размещено в той же сборочной единице; (2) правильно ли ориентированы парные концевые последовательности; и (3) если размер вставки in silico составлял от 50 000 до 250 000 п.н.Если размещение BES не соответствовало этим условиям, размещение BES было определено как дискордантное. Кроме того, если только одна из парных концевых последовательностей была выровнена со сборкой, размещение BES было определено как бесхозное размещение. Если обе последовательности с парным концом не были выровнены по отношению к сборке, BES был определен как несопоставленный. Если одна из последовательностей с парными концами была выровнена по разным позициям сборки несколько раз, BES была определена как имеющая несколько размещений.

    Закрытие разрыва и анализ SV: выравнивание с эталонным геномом

    Для определения точного геномного местоположения каждой сборочной единицы мы использовали LASTZ 25 с параметрами (-gapped -gap = 600,150, -hspthresh = 4500, -seed = 12of19 -notransition -ydrop = 15000-chain) для выравнивания каждой сборочной единицы с каждой хромосомой в эталонном геноме человека.Процедура сцепления использовалась для объединения соседних локальных выравниваний в единое связное выравнивание. Цепные выравнивания каждой сборочной единицы были обработаны, чтобы получить единственное выравнивание с наилучшей оценкой выравнивания. Если выбранное выравнивание не было полностью репрезентативным для сборочной единицы, мы выбрали набор выравниваний, который лучше представлял бы сборочную единицу. Затем была проведена процедура плетения с выбранными цепными выравниваниями. Процедуры связывания и объединения применялись с использованием инструментов UCSC Kent 26 , а параллельная обработка использовалась, когда это было возможно, для увеличения скорости вычислений.

    Закрытие разрыва GRCh48

    Разрывы были классифицированы на теломерные, центромерные, гетерохроматические, акроцентрические и эухроматические области в соответствии с файлом agp и информацией о цитобандах, предоставленной Консорциумом ссылок на геном (GRC) и браузером генома UCSC. В общей сложности 190 эухроматических промежутков были нацелены на закрытие промежутка с помощью сборки AK1. Зазоры, которые не могли быть закрыты или расширены с помощью узла AK1, были закрыты посредством локальной сборки с использованием Canu 27 или смежной подпитки.Для локальной сборки были выбраны субпотоки, отображаемые на 10 kb выше или ниже промежутка. Выравнивание выполняли с помощью BLASR 28 -bestn 3, и использовали первичные выровненные чтения с качеством картирования 254. После этого собранные контиги выравнивали по их соответствующему положению разрыва для точной идентификации добавленных последовательностей. Подпотоки, используемые для закрытия пробелов, были выбраны в соответствии с критериями, описанными в дополнительной информации.

    Обнаружение вариантов на основе сборки

    Выравнивания сборки с эталонным геномом были проанализированы для получения SNP, инделей и SV, которые мы определили как вставки, делеции, инверсии и сложные варианты с размером события, равным или превышающим 50 п.н.Сложные SV такие же, как «двусторонняя вставка», определенная ранее 29 . Мы использовали GRCh47 вместо GRCh48 для основного анализа для совместимости и сравнения с ранее сообщенными структурными вариациями.

    SV аннотация

    Элементы-повторы были аннотированы с помощью RepeatMasker (-species human -no_is) и тандемного средства поиска повторов (TRF) (2 7 7 80 10 50 2000 -f -m -h -d). SV классифицируются соответственно, если они замаскированы не менее чем на 70% одним типом. Комплекс определяется как SV, имеющие либо несколько аннотированных повторяющихся элементов, либо не менее 30% оставшейся последовательности, не аннотированной как повторяющиеся.Новизна была выявлена ​​путем сравнения контрольных точек с критерием 50% взаимного перекрытия. Функциональная аннотация была выполнена с использованием обоих выпусков GENCODE v19 (GRCh47) и v21 (GRCh48) 30 и Ensembl Regulatory Build 31 . Для тех SV, которые возникли в пределах регуляторных доменов генов, мы аннотировали ближайшее название гена. SV, расположенные внутри перицентромерных областей (5 т.п.н., фланкирующих аннотированные центромеры) и субтеломерных областей (150 т.п.н. от аннотированной теломерной последовательности), были аннотированы как гетерохроматин.Области маски генома пилотной и строгой доступности (версия 20141020) были загружены с ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/release/20130502/supporting/accessible_genome_masks/. Сайты сегментного дублирования были загружены из браузера таблиц UCSC. Чтобы упростить категоризацию SV, которые лежат в нескольких функциональных областях, они были классифицированы в соответствии с порядком приоритета следующим образом: кодирующая последовательность, нетранслируемая область, интрон, сайт связывания фактора транскрипции, промотор, энхансер, CTCF (репрессор транскрипции), и межгенный.Чтобы пояснить, использовались ли SV, вызванные из GRCh47, также совместно с наборами SV GRCh48, мы сравнили каждую контрольную точку AK1 с критерием взаимного перекрытия 50%. Кроме того, мы оценили, были ли SV, вызванные из GRCh48, также представлены в альтернативных контигах, измеряя согласованность с областями SV, включая окружающие 50 п.н. от контрольных точек.

    Азиатско-специфические SV

    Популяционная частота аллелей SV была получена путем сопоставления считываний из 38 образцов с высоким охватом из пяти различных предков (африканский, американский, европейский, восточноазиатский и южноазиатский) со сборкой AK1.Мы получили данные полногеномного секвенирования 23 человек из проекта «1000 геномов» и дополнительно секвенировали 15 человек из Восточной Азии (5 японцев, 5 китайцев и 5 корейцев). Кандидаты для анализа были отобраны из вставок с менее чем 70% повторов. Мы исключили любые дублирования среди вставок, которые сопоставлены с GRCh47 с помощью BLAST (-evalue 1e-10 -perc_identity 90 -qcov_hsp_perc 90). Области, которые были распознаны программами RepeatMasker и TRF как мобильный элемент или тандемный повтор, были замаскированы для анализа.Нормализованная глубина чтения в пределах уникальной последовательности была достигнута путем деления глубины чтения, рассчитанной с помощью samtools bedcov, на медианный охват генома. Установлено, что вставки являются высокополиморфными, если разница в частоте вариантов больше или равна 0,3 в разных популяциях. Специфические для Азии вставки были выбраны путем отбора вставок с разницей частот аллелей равной или более 0,3 между азиатской и неазиатской популяциями, а также частотой неазиатских аллелей равной или меньшей 0.5. Азиатские блоки неравновесного сцепления были получены из восточноазиатских образцов в фазе 3 проекта «1000 геномов» с использованием алгоритма S-MIG ++ 32 (-maf 0,05 -ci AV-вероятность 0,95). Блоки неравновесного сцепления с индексом разнообразия гаплотипов ниже 0,8 были исключены.

    De novo phasing markers

    Мы выполнили фазирование относительно сборки de novo . SNP и короткие индели, вызванные из полногеномного секвенирования (72 ×) коротких чтений, были разделены на связанные чтения.Неизбыточный набор подпотоков PacBio был выровнен по сборке, и были внесены поправки путем вычисления максимально вероятного вариантного аллеля для фазированных вариантов на основе глубины считывания. Фазированный блок был определен как область, охватывающая два маркера, у которых была подпочтенная или связанная информация чтения, обеспечивающая фазирование. Подобно связанным считываниям, секвенированная Illumina информация о фазах ВАС использовалась для корректировки маркеров фазирования и расширения фазированных блоков. Коррекция и другие методы биоинформатики были выполнены с использованием собственного скрипта, описанного в дополнительной информации.

    Ошибка переключения маркеров фазирования

    Измерения ошибки переключения дальнего действия были получены с использованием конечных последовательностей BAC. Концевые последовательности были выровнены со сборкой AK1 с помощью bwa mem, и базовый аллель сайта фазирующего маркера был вызван с соответствующей информацией ВАС. Когда переключение происходило для более чем двух маркерных сайтов в поэтапном блоке, это определялось как переключение дальнего действия. Частота ошибок переключения дальнего действия рассчитывалась как: нет. переключателей дальнего действия / нет. маркеров фазирования.

    Сборка Haplotig

    Используя окончательный набор маркеров фазирования, субпотоки были классифицированы в наборы гаплотипа A или B, когда совпадали> 85% маркеров фазирования. Когда субчитка не содержала маркера, она была классифицирована как гомозиготная. По глубине считывания дополнительно вызывались маркеры фазирования, пропущенные на предыдущих этапах, для гомозиготных областей, прилегающих к фазированным блокам. Субпотоки в гаплотипе A или гомозиготных областях были собраны в гаплотиг A, а гаплотип B в гаплотиг B с помощью Canu 27 .Гаплотиги для MHC класса I и II собирали отдельно, чтобы избежать неправильной сборки из-за высокой гомологии последовательностей между генами HLA. В этом случае субпотоки, фазированные как гомозиготные, использовали с субпотоками гаплотипов A и B. Гомозиготно фазированные субпотоки, фланкированные с каждой стороны разрыва в секвенировании, принадлежали гаплотипам A и B, соответственно, и были переклассифицированы во время сборки.

    Вызов и аннотация вариантов, зависящих от гаплотипа

    Варианты, зависящие от гаплотипа, были вызваны после метода вызова вариаций на основе сборки.Из-за возможности ложных срабатываний, вызванных неправильной сборкой, для дальнейшего анализа использовались поэтапные варианты, которые согласовывались с исходными вариантами, называемыми чтениями секвенирования всего генома. После функциональной аннотации с использованием GENCODE v19 (ссылка 30) аллели риска заболевания были проверены с помощью ClinVar 33 . Гаплотипирование CYP2D6 было выполнено путем сравнения гаплотигов с M33388 по номенклатуре CYP2D6 .

    De novo сборка клонов ВАС и проверка SV

    ВАС, идентифицированные как несовместимые по размеру (> 1 т.п.н.), были объединены и секвенированы с помощью платформы SMRT.Субпоследовательности собирали с использованием Canu 27 после скрининга и удаления Escherichia coli или векторных последовательностей с помощью CrossMatch 34 . Собранные контиги ВАС полировали с помощью Quiver. После этого контиги ВАС использовались для проверки достоверности SV на основе сборки AK1 или фазоспецифичных SV путем оценки соответствия между сборкой и контигом BAC в сайтах обнаруженных SV.

    Гетерозиготность и аллель-специфическая экспрессия

    На основе выравнивания гаплотигов с GRCh47 были локализованы гаплотиги A и B для сравнения партнерских последовательностей.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *