Ассоциация рорс: Контакты — Росохотрыболовсоюз Официальный сайт

Содержание

Новости — Росохотрыболовсоюз Официальный сайт

Дата публикации: .

Онлайн-конференция, посвященная Московской международной выставке оружия и товаров для охоты «ORЁLEXPO* 2021», которая пройдет с 14 по 17 октября в Московском гостином дворе.

Участники:

  • организатор выставки «ORЁLEXPO 2021» Михаил ХУБУТИЯ;
  • президент Росохотрыболовсоюза Татьяна АРАМИЛЕВА;
  • главный редактор журнала «Калибр» Александр КУДРЯШОВ;
  • программный директор выставки «ORЁLEXPO 2021» Ирина Гордина.

Цель отраслевой выставки (16+) – объединение на одной площадке производителей, продавцов, пользователей гражданского, охотничьего, спортивного и холодного оружия, законодателей, регулирующих оборот оружия, профессионалов из сфер безопасности и туризма, экологии и регионального развития.

Насыщенная деловая программа с участием представителей Министерства экономического развития РФ, Министерства природных ресурсов и экологии РФ, компаний-производителей оружия и специальной техники включает экспертные дискуссии, лекции и мастер-классы, пресс-конференцию ведущих экспертов по оружию и охоте.

Одной из главных тем станет проблема безопасности граждан и законодательных изменений в отношении использования гражданского оружия. События последних лет делают все более актуальной тему культуры обращения с оружием и строгости соблюдения законодательных норм при выдаче разрешений. Об этом будут говорить депутаты Государственной Думы РФ и члены Общественной Палаты РФ, представители стрелковых сообществ, производители, психологи и юристы. Также эксперты рассмотрят вопросы развития охоты и стрельбы в аспекте охраны природы и сохранения традиций стрелкового дела в России.

Выставка «ORЁLEXPO» стала одной из самых знаковых в оружейной отрасли B2B-площадкой. Она открывает огромные возможности для обмена опытом, поиска деловых партнеров и заключения контрактов. В 2020 году выставку с участием 130 экспонентов посетили более 13 тысяч гостей, в дискуссиях приняли участие более 100 экспертов. Количество экспонентов выставки 2021 года – уже более 150.

* ОРЁЛЭКСПО

Источник: http://pressmia.ru/pressclub/20211011/953380799.html

4.10 https://gold10.ru/news/29677/
5.10 https://vvesti.com/obshchestvo/v-stolice-projdet-mezdunarodnaa-vystavka-oruzia-i-tovarov-dla-ohoty-orelexpo-2021
5.10 https://www.infox.ru/press/news/263476-orel-expo-snova-v-gostinom-dvore
6.10 https://vm.ru/news/916935-vystavka-oruzhiya-orelexpo-projdet-v-gostinom-dvore
6.10 https://www.gosrf.ru/oryol-expo-snova-v-gostinom-dvore-partnerom-vystupil-mediaholding-regiony-rossii/

6.10 https://infocus.press/orel-expo-snova/
6.10 https://woman.rambler.ru/fashion/47334411-vystavka-oruzhiya-orelexpo-proydet-v-gostinom-dvore/
6. 10 https://www.ridus.ru/news/363784
6.10 https://wall.wayxar.com/news/na_vystavke_oryelexpo_v_moskovskom_gostinom_dvore_proydet_prezentatsiya_mobilnogo_prilozheniya_strel
7.10 https://tverskaya13.ru/puls-goroda/oryolexpo-ob-oruzhii-i-kul-ture-obrashheniya-s-oruzhiem-ot-pervy-h-lits-otrasli/
7.10 http://expert.ohotnik.com/review/news/114

Дата публикации: .

По сообщениям уральских СМИ в ряде муниципалитетов Свердловской области из-за африканской чумы свиней введен режим чрезвычайной ситуации (ЧС).

http://urbc.ru/1068107025-v-sverdlovskoy-oblasti-obyavlen-rezhim-chs-iz-za-afrikanskoy-chumy-sviney.

html

Те же СМИ сообщают, что в ходе оперативных мероприятий в связи со вспышкой вируса африканской чумы свиней в лесу Камышловского района была обнаружена свалка свиных туш. Пробы, взятые ветеринарами, выявили заражение всех 37 животных вирусом.

Как правило, после обнаружения АЧС на территории субъекта Российской Федерации устанавливается запрет охоты на все виды животных в радиусе 20 км от очага, который, по мнению ветеринарных специалистов должен способствовать разрыву эпизоотической цепи. (При этом пребывание и передвижение граждан в лесу, транспортных средств никак не ограничивается).

Почему-то считается, что кабаны являются причиной значительного числа случаев АЧС, хотя очевидно, что именно антропогенный механизм распространения вируса имеет первостепенную роль.

Между тем, еще 1 августа 2021 года в СМИ прошла информация о том, что в Свердловской области установлен карантин из-за обнаружения свинины, зараженной африканской чумой. По предварительным данным, поставщиком опасной продукции оказалось ООО «Поречье» из Калининградской области, где ранее были зафиксированы вспышки африканской чумы свиней (http://urbc.ru/1068080620-v-ekaterinburge-vyyavlena-svinina-s-afrikanskoy-chumoy.html).

С учетом этих фактов становится ясно, почему курс на борьбу с кабанами, взятый в рамках предотвращения распространения АЧС, не привел к искоренению заболевания.

Напоминаем, что Общественная организация «Союз охотников и рыболовов Свердловской области» обратилась в Верховный суд РФ об оспаривании п.1 и 1.1 раздела III Плана действий по предотвращению заноса на территорию РФ африканской чумы свиней и ее распространения на территории РФ, утв. распоряжением Правительства РФ от 30.09.2016 № 2048-р «»Об утверждении плана действий по предотвращению заноса на территорию Российской Федерации африканской чумы свиней и ее распространения». Рассмотрение дела назначено на 12.10.2021.

Дата публикации: .

VII Всероссийские соревнования охотников с ловчими птицами «Слёт сокольников – 2021» состоялись 1 – 3 октября в Липецкой области в Усадьбе «Скорняково – Архангельское» в рамках фестиваля «Дни дворянской охоты». Основной целью проведения фестиваля была популяризация основных видов российской охоты и сохранения элементов нематериального культурного наследия России.

В слёте приняли участие 10 сокольников. Все участники имели «разрешение на содержание ловчей птицы в полувольных условиях и искусственно созданной среде обитания» и охотничий билет. Слёт сокольников — 2021″ проходил в формате двух независимых частей:

  1. Спортивно-соревновательная часть (без контакта ловчих птиц с добычей), представляла собой зрелищные гонки ловчих птиц на время.
  2. Развлекательная часть, которая особенно понравилась гостям Слёта. Завораживающие полёты ловчих птиц и различные трюки не оставили зрителей равнодушными, к этой древней традиции.

Участников соревнований охотников с ловчими птицами ждали награды и дипломы от устроителей фестиваля. Дипломом Президента Росохотрыболовсоюза « за весомый вклад в развитие соколиной охоты в России» награжден Президент НКО Союз сокольников «Русский сокол», д.б.н. Еналеев Ильдар Рустямович.

С каждым годом фестиваль собирает всё большее количество гостей, которым интересна тема охоты и тем более интересна соколиная охота. Участники и гости слёта благодарят устроителей за интересное, зрелищное, насыщенное и прекрасно организованное мероприятие.

Консультант по охотничьим трофеям Жуков Г.А.

Дата публикации: .

23 сентября 2021 года состоялась отчётно-выборная конференция Калужской областной общественной организации охотников и рыболовов Российской ассоциации общественных объединений охотников и рыболовов «Росохотрыболовсоюз».

Председателем правления КРООООиР на очередной срок снова избран Михаил Георгиевич Вишневский.

Поздравляем делегатов конференции и всех членов Калужской ООООиР с успешным завершением отчётно-выборной кампании. Желаем руководству общества и всем его членам дружной работы, успехов в развитии охоты и рыболовства, ведении охотничье-рыболовного хозяйства, охране Родной Природы!

Центральное правление Росохотрыболовсоюза

Дата публикации: .

Участились случаи привлечения охотпользователей к ответственности за неисполнение мероприятий по регулированию численности кабана, принуждению к достижению показателей плотности кабана, указанных в письмах Минприроды России. В Рекомендациях высшим должностным лицам субъектов Российской Федерации (руководителям высших исполнительных органов государственной власти субъектов Российской Федерации) по определению и регулированию плотности кабана на тысячу гектар, а также о мерах по предотвращению АЧС среди диких кабанов в субъектах Российской Федерации, утвержденных 27.02.2020 № 0005/12 (Далее – Рекомендации Минприроды России) содержатся «рекомендованные» мероприятия, том числе снижение плотности кабана (до 0,25 ос/1000 га), основанные, в свою очередь, на рекомендациях Плана действий по предотвращению заноса на территорию Российской Федерации африканской чумы свиней и ее распространения, утвержденного Распоряжением Правительства РФ от 30. 09.2016 № 2048-р. В Законе об охоте, приказах Минприроды России подобные нормы не содержатся. Возникла ситуация, когда охотпользователей обязывают выполнять «рекомендованные» мероприятия, проверяют их исполнение и наказывают за не исполнение «рекомендаций».

В связи с этим, Общественная организация «Союз охотников и рыболовов Свердловской области» обратилась в Верховный суд РФ об оспаривании п.1 и 1.1 раздела III Плана действий по предотвращению заноса на территорию РФ африканской чумы свиней и ее распространения на территории РФ, утв. распоряжением Правительства РФ от 30.09.2016 № 2048-р «»Об утверждении плана действий по предотвращению заноса на территорию Российской Федерации африканской чумы свиней и ее распространения». Рассмотрение дела назначено на 12.10.2021. Росохотрыболовсоюз, в свою очередь, 02.09.2021 обратился в Минюст России, с просьбой провести правовую экспертизу Рекомендаций Минприроды России.

Кроме того, по результатам обращения Росохотрыболовсоюза к Вице-премьеру, председателю противоэпизоотической комиссии Абрамченко В. В., представитель Росохотрыболовсоюза будет включен в состав Постоянно действующей противоэпизоотической комиссии Правительства РФ.

Дата публикации: .

Росохотрыболовсоюз принял участие в работе второго охотничего фестиваля «Записки охотника», прошедшего 4 сентября 2021 г. в музее-заповеднике И.С. Тургенева «Спасское-Лутовиново». С приветственными словами к гостям фестиваля обратились Губернатор Орловской области А.Е.Клычков, главный редактор «Российской охотничьей газеты» А.И.Лисицин; заместитель Президента Росохотрыболовсоюза А.А.Сицко, Председатель Орловской областной общественной организации охотников и рыболовов Е. А.Буданова.

Гостей фестиваля встречали крылатые фразы из произведений И.С. Тургенева с охотничьей тематикой.

Открыло праздничную программу занятное театрализованное представление, где встретились авторы и персонажи разных произведений, начиная от барона Мюнгхаузена до известного генерала из фильма про национальную охоту.

Вся атмосфера фестиваля была пропитана теплотой воспоминаний о великом писателе на фоне общения с природой, а охотничья тематика так же зримо и вместе с тем незаметно вплетена в дневные мероприятия, как через охоту описывал И.С.Тургенев далекую теперь от нас сельскую жизнь. Круглый стол, где обсуждались охотничьи дела области поразил нас редким на сегодняшний день взаимопониманием власти, охотпользователей и охотников в решении насущных проблем.

С точки зрения понимания современным обществом охотничьих традиций нельзя не отметить включение в программу фестиваля выставки охотничьих собак и состязания подсадных уток. Также был интересен уголок поляны, где предлагалось по силуэтам определить охотничьих зверей и птиц.

Наибольший интерес всех присутствующих вызвала реконструкция дворянской охоты с демонстрацией работы русских псовых борзых, погоня которых за искусственным зайцем вызвала бурю восторга.

Ненастная погода внесла свои коррективы, надеемся, что конкурс охотничьих баек, не состоявшийся из-за внезапного ливня, мы увидим в следующем году. Нынче же всех согревали мастер класс по приготовлению блюд охотничьей кухни и гастрономические ряды.

Росохотрыболовсоюз благодарен директору музею-заповедника И.С. Тургенева «Спасское-Лутовиново» С.А.Ступину, его заместителю И.В.Никишонковой, всему коллективу музея, за организацию второго охотничьего фестиваля и надеется на его превращение в традиционные осенние встречи на Мценской земле.

Росохотрыболовсоюз приветствует организацию фестиваля и готов оказать помощь и поддержку его в его проведении.

Дата публикации: .

Общественный резонанс вызвал снимок неизвестного автора, где он выложил телами убитых птиц фразу: «Чукотка 2021». Общественность разделилась на два лагеря, большинство осудили поступок алчного охотника. Однако нашлись и те, кто не усмотрел в действиях мужчины ничего криминального. Нарушил ли охотник требования законодательства и можно ли считать отдыхом убийство животных в эфире Общественной службы новостей говорили гости программы.

Спикеры:

  • Президент Росохотрыболовсоюза Татьяна Арамилева.
  • Председатель общественной организации «Альянс защитников животных» Юрий Корецких.
  • Заместитель председателя комитета ГД по экологии и охране окружающей среды Кирилл Черкасов.
  • Научный руководитель программы по сохранению биоразнообразия WFF России Владимир Кревер.

Запись программы можно посмотреть по ссылке.

Дата публикации: .

До внесения изменений в Закон о животном мире и Закон об охоте Федеральным законом № 455-ФЗ, органы исполнительной власти субъектов РФ фактически имели возможность устанавливать любые ограничения охоты на свое усмотрение. При этом использовались нормы Закона о животном мире, а не Закона об охоте.

К примеру, произвольно ограничивалась/закрывалась весенняя охота, ограничивалась охота на зайца или куропатку только в охотничьих хозяйствах общества охотников. Устанавливались ограничения по часам охоты, калибрам оружия, запрещалась охота на полях и тп. Апофеозом произвольных ограничений стала ситуация в Новосибирской области, когда под надуманным предлогом «снижения численности» закрыли охоту на лося осенью 2020 года, в разгар охотничьего сезона и при наличии утвержденных Губернатором лимитов и квот добычи, прошедших экологическую экспертизу и согласование Минприроды России.

Все это приводило к существенным издержкам при осуществлении деятельности охотпользователей, ограничению их прав, а в итоге – снижению инвестиционной привлекательности всей отрасли.

Согласование ограничений ранее производил Росприроднадзор, который не располагает штатом специалистов в сфере охоты и никогда не согласовывал своих действий с профильным департаментом Минприроды России.

Федеральным законом № 455-ФЗ из Закона о животном мире исключена возможность установления ограничений охоты.

В настоящее время порядок установления ограничений охоты регулируется исключительно Законом об охоте, ограничения согласуются с Минприроды России (через профильный Департамент) в рамках утвержденного порядка.

Приказ Минприроды России от 26 июля 2021 г. № 509 детализировал основания и сроки установления ограничений.

С точки зрения общественных объединений охотников, нельзя не поддержать новое регулирование, которое исключает возможность установления произвольных ограничений (читай — самоуправства) на усмотрение региональных властей.

Это позволит избежать форс-мажорных ситуаций, не раз случавшихся ранее из-за внезапного закрытия весенней охоты или сокращения ее продолжительности, исключит предвзятость ограничений в отношении отдельных охотпользователей и сделает более предсказуемой всю деятельность в сфере охоты.

Дата публикации: .

25 июля 2021 года состоялась отчётно-выборная конференция Мордовской республиканской общественно-спортивной организации «Общество охотников и рыболовов». Председателем МРОСО «ООиР» на очередной срок избран Вячеслав Геннадьевич Ильин.

Поздравляем делегатов конференции и всех членов Организации с успешным завершением отчётно-выборной кампании. Желаем руководству Общества и всем его членам дружной работы, успехов в развитии охоты и рыболовства, ведении охотничье-рыболовного хозяйства!

Центральное правление Росохотрыболовсоюза

Дата публикации: .

14 августа 2021 года состоялась отчётно-выборная конференция Краснярской краевой общественной организации охотников и рыболовов. Председателем правления РОО «КРАЙОХОТРЫБОЛОВОБЩЕСТВО» на очередной срок избран Юрий Яковлевич Борисенко.

Поздравляем делегатов конференции и всех членов Организации с успешным завершением отчётно-выборной кампании. Желаем руководству Общества и всем его членам дружной работы, успехов в развитии охоты и рыболовства, ведении охотничье-рыболовного хозяйства!

Центральное правление Росохотрыболовсоюза

Журналистам

8 Октября 2021  Управление информации и общественных связей Ростовской АЭС

8 Октября 2021  Управление информации и общественных связей Ростовской АЭС

8 Октября 2021  Пресс-служба Технической академии Росатома

8 Октября 2021  Пресс-служба проекта Homo Science

8 Октября 2021  АО «Концерн Росэнергоатом»

8 Октября 2021  Управление информации и общественных связей Нововоронежской АЭС

8 Октября 2021  Управление информации и общественных связей Кольской АЭС

8 Октября 2021  Управление информации и общественных связей Калининской АЭС

8 Октября 2021  Управление информации и общественных связей Калининской АЭС

8 Октября 2021 

8 Октября 2021  Управление информации и общественных связей Белоярской АЭС

8 Октября 2021  Управление информации и общественных связей Балаковской АЭС

8 Октября 2021  Управление информации и общественных связей Балаковской АЭС

7 Октября 2021  Управление информации и общественных связей Нововоронежской АЭС

7 Октября 2021  Управление информации и общественных связей Калининской АЭС


Журнал «Сафари» или Ассоциация РОРС зачем она охотникам? — — РОСОХОТСОЮЗ.

рф

Даже не знакомясь с вступительной «речью» владельца издания, достаточно прочесть фамилию издателя, чей журнал «Сафари» уютно разместился в здании РОРС у м. Водный стадион, чтобы понять ждать что-либо путного от преемника г. Бендерского, нового президента ассоциации г. Арамилевой не стоит. Одна «шайка-лейка». Но все же прочесть стоит, чтобы осознать, наша охота далеко не в надежных руках.

Новый век одновременно с новым тысячелетием стали своеобразной гранью, разделившей российскую охоту на «до» и «после». Именно российскую, поскольку в большинстве продвинутых стран мира она давно стала такой, какой мы ее узнали за эти полтора десятка лет. Согласитесь, понятия «горная охота»«трофейная охота»«трофейный зал»«оценка трофея»«охотничий и рыболовный туризм», как и многие им подобные, в 2000 году подавляющему большинству российских охотников были попросту малопонятны. Думаю, не ошибусь, если скажу, что первым увлекательнейший мир новой для россиян охоты открыл журнал «Сафари». Из его первых же номеров читатели смогли узнать о международных охотничьих клубах, организациях, книгах трофеев и наградах за выдающиеся трофеи. Не прошло и года с момента выпуска №1/2000, как уже не только члены Московского клуба «Сафари», но и большинство читателей охотничьей периодики знали, что такое «Биг Файв», «Грэнд слэм» (или Бараний шлем), кто такой «пиэйч» и «аутфиттер», а названия таких общественных организаций, как SCICIC и Ovis, прочно вошли в наш обыденный лексикон.

Но узнали мы не только о мире зарубежной охоты«Сафари» открыл глаза многим на те охотничьи богатства нашей страны, добыча которых является самой заветной мечтой огромного количества иностранных охотников. И в этой связи журнал с первых своих номеров заговорил об охоте, как о бизнесе.

Многих отечественных охотников журнал «Сафари» увлек ранее неизвестными для них охотами, зажег желанием отправиться за трофеями в дальние страны, собрать коллекцию трофеев. Кто-то поставил себе целью побывать в Африке, кто-то – стать обладателем Большой Африканской Пятерки, а кто-то – оказаться в первой десятке по той или иной номинации в Книге рекордов SCI. Лично у меня наибольший интерес вызвала непонятная многим охотникам лесов, степей и тундр тема горных охот – охот на баранов и козерогов, – с которой я волею судеб был знаком еще в юношеском возрасте. Она остается для меня приоритетной до настоящего времени и даже подвигла на инициацию создания такой награды «Росохотрыболовсоюза», как «Горная пятерка» (в период моей работы в РОРС). А в настоящее время – на создание российского Клуба Горных Охотников. Журналы, как люди, – рождаются, живут и уходят в иные миры. Правда, в отличие от людей, они могут возрождаться – так было, например, с «Природой и охотой». Этот журнал, воссозданный охотниками-энтузиастами, смог продержаться с начала девяностых до начала двухтысячных, но потом обстоятельства сложились так, что первое десятилетие нового века ему не суждено было перешагнуть.  Журнал «Сафари» просуществовал с 1999 по 2014 год – пятнадцать лет! И вполне мог бы стать долгожителем, но… целый ряд технических и юридических проблем привел к его закрытию. А нас – поклонников этого издания – к идее создания нового журнала «Магия Настоящего САФАРИ», которое продолжит во многом традиции «Сафари». Тем более, что редакция во главе с Анатолием Можаровым (который проработал в журнале «Сафари» 10 лет шеф-редактором) перешла в этот новый журнал.

И еще нужно сказать, что новое издание стало официальным рупором российского Клуба Горных Охотников. На страницах журнала мы уже рассказываем и будем рассказывать о проектах, планах и программах, реализуемых клубом. 

С уважением, Эдуард Бендерский,
издатель

Анализ Ассоциации приема различных глюкокортикоидов с развитием острого панкреатита с использованием системы отчетности о нежелательных явлениях Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США (FAERS) | Journal of Pharmaceutical Health Care and Sciences

Мы перечислили все предпочтительные термины (PT), которые использовались в настоящем исследовании для идентификации пациентов, у которых развился острый панкреатит (SMQ) и связанные с ним клинические состояния, в таблице 1. Мы извлекли в общей сложности 10 413 882 неблагоприятных исхода. события из базы данных FAERS.После очистки данных были проанализированы 8 437 343 случая. Мы выявили 16 431, 3580, 84 411, 11 363, 50, 242, 23 496 и 3825 случаев, у которых развились какие-либо нежелательные реакции при приеме кортизола, кортизона, дексаметазона, триамцинолона, преднизолона, метилпреднизолона и бетаметазона соответственно. Эти числа соответствовали 0,19, 0,04, 1,00, 0,13, 0,60, 0,28 и 0,05%, соответственно, от общего числа случаев развития любых нежелательных реакций, которые использовались для анализа в настоящем исследовании (т. Е. 8 437 343 случая).В общей сложности 44 893 случая развития острого панкреатита (SMQ) были выявлены на фоне приема любых лекарств, включая глюкокортикоиды. Как показано в таблице 2, в 146, 22, 387, 50, 353, 220 и 24 случаях пациентов, у которых развился острый панкреатит (SMQ) при приеме кортизола, кортизона, дексаметазона, триамцинолона, преднизолона, метилпреднизолона и бетаметазона, соответственно. В результате количество этих случаев составило 0,32, 0,05, 0,86, 0,11, 0,79, 0,49 и 0,05% от общего числа случаев развития острого панкреатита (ОГП) (т.е., 44 893 случая) соответственно.

Таблица 2 Число случаев пациентов, у которых развился острый панкреатит (SMQ; 20000022) во время лечения глюкокортикоидами, и ROR для соответствующих глюкокортикоидов

Результаты анализа показали, что ROR, рассчитанные для кортизола, преднизолона и метилпреднизолона, были значительно ( p <0,01) повышается при использовании данных, включающих все уровни достоверности (таблица 2), тогда как сигнал дексаметазона был значительно меньше единицы.Напротив, когда анализ проводился с использованием только данных с более высокой степенью достоверности для ассоциации глюкокортикоидов с побочными эффектами, ROR для преднизолона, метилпреднизолона и дексаметазона считался значительно повышенным ( p <0,01). Мы посчитали, что сигнал для бетаметазона незначительный. Значение p ROR, рассчитанное с помощью точного критерия Фишера, было немного больше 0,05, хотя нижний предел 95% доверительного интервала был больше 1.0 (таблица 2). Сигнал для триамцинолона был значительно меньше единицы. Кроме того, было несогласованность в отношении ROR дексаметазона, которые были рассчитаны с использованием ВСЕХ данных и данных PS + SS.

В таблице 3 мы показали результаты анализа диспропорциональности, выполненного с использованием различных PT для трех глюкокортикоидов (т.е. преднизолона, метилпреднизолона и дексаметазона), которые показали значительно преувеличенные сигналы для острого панкреатита (SMQ). ROR, рассчитанные для комбинаций преднизолона или метилпреднизолона и двух ПВ (острый панкреатит и некротический панкреатит), были статистически значимыми ( p <0.01) повышается независимо от уверенности репортеров в причинно-следственной связи (т.е. ALL и PS + SS) (Таблица 3). Напротив, результаты анализов для других трех ПК (панкреонекроз, ишемический панкреатит и геморрагический некротический панкреатит) были неубедительными, главным образом из-за нехватки образцов.

Таблица 3 Число случаев, у которых были зарегистрированы случаи развития различных ПВ при приеме каждого из глюкокортикоидов и ROR для соответствующих комбинаций ПВ и лекарств

Мы нарисовали графики вулканов для трех глюкокортикоидов, которые показали статистически значимые избыточные сигналы для острого панкреатита ( SMQ: 20000022), когда анализ проводился с использованием данных всех уровней уверенности репортеров в причинно-следственной связи (рис.1) и когда анализ проводился с использованием данных с большей достоверностью (рис. 2). Графики показали, что ПВ «острого панкреатита» имеет наивысшие уровни статистической значимости по сравнению с другими ПВ, хотя величина сигнала была менее впечатляющей, чем более конкретные ПВ, независимо от уверенности репортеров в причинно-следственной связи между нежелательными реакциями и введением. глюкокортикоидов (рис. 1 и 2). Напротив, более специфические PT, включая геморрагический некротический панкреатит и ишемический панкреатит, имели более сильные изменения сигнала ROR, но их статистическая значимость была ниже, чем PT острого панкреатита. Наборы данных для дренирования псевдокисты поджелудочной железы (PT; 10033636), панкреаторенального синдрома (PT; 10056277), флегмоны поджелудочной железы (PT; 10056975), наследственного панкреатита (PT; 10056976), признака Каллена (PT; 10059029), признака Грея Тернера (PT; 10075426) ) не были построены, так как случаи не были собраны из базы данных.

Рис. 1

График вулкана для визуализации статистической значимости ( p -значений) и величины сигналов тревоги (отношения шансов отчетности; ROR) для 18 PT, которые использовались для выявления развития острого панкреатита (SMQ) во время приема преднизолона, метилпреднизолона и дексаметазона.ROR были рассчитаны с использованием представленных данных, включая все уровни уверенности репортеров в причинно-следственной связи

Отрицательный десятичный логарифм (с основанием 10) p -значений (-log10 P) отложены по оси ординат, а натуральный логарифм ( к основанию e) ROR (ln ROR) откладываются по оси абсцисс. Горизонтальная линия представляет порог значимости ( p = 0,05), скорректированный на множественные сравнения методом Бонферрони ( p = 0,00093)

Рис.2

График вулкана для визуализации статистической значимости ( p -значения) и величина тревожных сигналов (отношение шансов в отчетах; ROR) для 18 PT.Отрицательный логарифм (с основанием 10) p-значений (-log10 P) нанесен на график на графике. ось y и натуральный логарифм (с основанием e) ROR (ln ROR) нанесены на ось x. Горизонтальная линия представляет порог значимости ( p = 0,05), скорректированный на множественные сравнения по методу Бонферрони ( p = 0.00093)

Связи делирия с антибиотиками: исследование фармаконадзора системы отчетности о нежелательных явлениях FDA (FAERS)

Наши результаты показали значительную связь делирия (от самого сильного до самого слабого) со следующими классами антибиотиков: карбапенемы, макролиды, фторхинолоны, цефалоспорины , и комбинации пенициллина (рис. 2).

Наши результаты продемонстрировали значительную связь делирия (от самого сильного до самого слабого) со следующими антибиотиками: эртапенем, цефепим, имипенем, офлоксацин, цефтазидим, кларитромицин, цефаклор, ампициллин – сульбактам, левофлоксацин, линезацил-моксифлоксацин, моксифлоксифлоксацин. триметоприм – сульфаметоксазол, метронидазол, ципрофлоксацин и цефуроксим (рис.2). Наши результаты согласуются с ранее известными ассоциациями делирия с эртапенемом, цефепимом, имипенемом, офлоксацином, цефтазидимом, кларитромицином, цефаклором, левофлоксацином, линезолидом, моксифлоксацином, азитромицином, пиперациллин-тазобактамом, триметронидазол и сульфаметронидазол [5]. 6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24]. Было обнаружено, что ампициллин-сульбактам связан с делирием при FAERS, о ​​чем не сообщалось в литературе.

Известно, что цефепим способен вызывать нейротоксичность благодаря своей способности преодолевать гематоэнцефалический барьер и проявлять зависящий от концентрации конкурентный антагонизм гамма-аминомасляной кислоты (ГАМК) [30,31,32]. Признаки и симптомы нейротоксичности, вызванной цефепимом, включали изменение психического статуса, снижение сознания, спутанность сознания, миоклонус, афазию, возбуждение и судороги [32]. Многие признаки и симптомы нейротоксичности, вызванной цефепимом, хорошо коррелировали с признаками и симптомами делирия [1]. Поэтому неудивительно, что обнаружение значительной связи между цефепимом и делирием у FAERS.

Карбапенемные антибиотики могут иметь более высокий нейротоксический потенциал, чем пенициллины и цефалоспорины [33].Действительно, в нашем исследовании класс антибиотиков карбапенема имел самый высокий ROR делирия среди всех классов антибиотиков, включенных в исследование (рис. 1). Это может быть не общеклассовый эффект, и некоторые карбапенемы могут быть более агрессивными (например, имипенем), чем другие (например, меропенем). Предыдущие исследования показали, что цефепим может иметь в десять раз больший риск нейротоксичности, чем меропенем [34, 35]. Считалось, что нейротоксичность карбапенемов вызвана взаимодействием с рецепторами ГАМК [33]. Связь между имипенемом и делирием, обнаруженная при FAERS, может быть связана с этим механизмом.

Хотя делирий, вызванный ампициллин-сульбактамом, не описан в литературе, ампициллин-сульбактам является бета-лактамом, который может вызывать нейротоксичность за счет взаимодействия с рецепторами ГАМК [31]. Связь между ампициллин-сульбактамом и делирием, обнаруженная при FAERS, может быть объяснена этим механизмом. Интересно, что ампициллин-сульбактам был связан с делирием, учитывая его минимальное проникновение через гематоэнцефалический барьер. В предыдущих отчетах указывалось, что его пенетрантность составляет 1% от концентрации в плазме и увеличивается только при воспалении мозговых оболочек [36].

Хотя в литературе сообщалось о случае делирия, связанного с меропенемом, в нашем исследовании не было обнаружено статистически значимого ROR для меропенема и делирия. Низкое количество сообщений о меропенемном делирии в FAERS может быть причиной статистической незначимости (рис. 2).

При анализе подгрупп, порядок ранжирования ROR делирия в обеих подгруппах (<65 лет и ≥ 65 лет) был аналогичен таковому у всех пациентов. Наши результаты показали, что пожилые пациенты имели более высокий ROR делирия, чем более молодые пациенты среди большинства проанализированных классов антибиотиков (рис.3). Карбапенемы, макролиды, фторхинолоны, цефалоспорины и триметоприм-сульфаметоксазол имели значительно большую связь с делирием у пожилых пациентов, чем у более молодых пациентов. Известно, что риск делирия выше у пожилых пациентов [1]. Следует отметить, что ципрофлоксацин и триметоприм-сульфаметоксазол также были включены в критерии Пива Американского гериатрического общества в отношении потенциально несоответствующего применения лекарств у пожилых людей [37]. Ципрофлоксацин входил в критерии Бирса для разрыва сухожилий и гиперкалиемии, но не для делирия.

Ограничения

Причинно-следственная связь между лекарственным средством и ADR не может быть определена FAERS. Существенная предвзятость может возникнуть из-за спонтанного и добровольного сообщения о нежелательных реакциях. Внимание средств массовой информации и недавняя публикация АРС в литературе могут повлиять на поведение при составлении отчетов. Связь между лекарственным препаратом и нежелательной реакцией осложняется из-за сопутствующих заболеваний и сопутствующих лекарств. Согласно FDA, представленная информация не была проверена медицинским работником. Данные FAERS могут быть предоставлены медицинскими работниками, потребителями и производителями.Необходимо учитывать источник подачи. Некоторая информация отсутствует или неполна в FAERS. Были случаи, когда возраст не сообщался или названия лекарств были написаны с ошибками. FDA не получает отчеты по каждому нежелательному явлению или ошибке приема лекарств, которые происходят с продуктом. Кроме того, ROR исследует только повышенный риск сообщения о нежелательных реакциях, а не риск возникновения нежелательных реакций в абсолютном выражении [38]. Некоторые доверительные интервалы довольно широки, например, цефаклор 5,32 (1,71–16,58) из-за небольшого количества отчетов о ROR по цефаклору для делирия.Дополнительным ограничением этого исследования является использование слова «делирий» в качестве поискового запроса в базе данных FAERS. Такие термины, как делирий, энцефалопатия, острое состояние спутанности сознания, острая дисфункция головного мозга и острая мозговая недостаточность, часто используются в литературе как синонимы и неуместно [39]. Без возможности определить, как был диагностирован делирий, возможно, что многие случаи были неправильно классифицированы и могли повлиять на результаты. Несмотря на ограничения, FAERS имеет большой размер выборки и подходит для обнаружения сигнала о новых и редких ассоциациях лекарств и побочных эффектов.

Скорректированный ROR для геморрагических событий

Фон Гиперплазия десен, вызванная лекарствами (DIGH), вызывает проблемы с жеванием, эстетикой и произношением, а также приводит к ухудшению качества жизни пациента (QOL). Таким образом, целью данного исследования было оценить заболеваемость DIGH с использованием баз данных системы спонтанных сообщений (SRS). Методы Мы проанализировали отчеты о DIGH из баз данных SRS и рассчитали отношение шансов (ROR) предполагаемых лекарств (иммунодепрессантов, блокаторов кальциевых каналов и противосудорожных средств).В качестве баз данных SRS использовались Система отчетности о нежелательных явлениях Управления по контролю за продуктами и лекарствами США (FDA) (FAERS) и база данных отчета о нежелательных явлениях в Японии (JADER). Используя данные, мы оценили профиль времени до возникновения и тип опасности, используя параметр формы Вейбулла (WSP). Кроме того, мы использовали метод интеллектуального анализа ассоциативных правил, чтобы обнаружить необнаруженные взаимосвязи, такие как возможные факторы риска. Полученные результаты FAERS содержал 5 821 716 отчетов. ROR (95% доверительный интервал: ДИ) для циклоспорина, эверолимуса, сиролимуса, микофенолятмофетила, амлодипина, нифедипина, карбамазепина, клобазама, леветирацетама, фенобарбитала, фенитоина, примидона, топирамата и вальпроевой кислоты составляли 39. 4 (95% ДИ: 30,3–51,2), 4,2 (1,7–10,0), 6,6 (2,5–17,7), 13,1 (7,2–23,2), 94,8 (80,0–112,9), 57,9 (35,7–94,0), 15,1 (10,3– 22,3), 65,4 (33,8–126,7), 6,5 (3,6–11,8), 19,7 (8,8–44,0), 65,4 (52,4–82,9), 56,5 (21,1–151,7), 2,9 (1,1–7,7) и 17,5 (12,6–2,8) 24.4) соответственно. База данных JADER содержала 430 587 отчетов. Среднее время до начала гиперплазии десен для иммунодепрессантов, блокаторов кальциевых каналов и противосудорожных препаратов составляло 71, 262 и 37 дней соответственно. Кроме того, 95% доверительный интервал WSP β для противосудорожных средств был превышен и исключен 1, что означало, что они относятся к типу отказа из-за износа.Выводы Наши результаты показывают, что DIGH-мониторинг пациентов, которым вводят иммунодепрессанты, блокаторы кальциевых каналов или противосудорожные препараты, важен. Мы продемонстрировали потенциальный риск DIGH после длительного использования блокатора кальциевых каналов в течение примерно 260 дней. Основываясь на результатах метода интеллектуального анализа ассоциативных правил, пациенты с умственной отсталостью, которым вводят фенитоин, должны находиться под тщательным наблюдением. Мы рекомендуем тщательно наблюдать за пациентами, у которых наблюдаются симптомы, связанные с DIGH.

Связь между аффинностью связывания рецепторов и профилем метаболических побочных эффектов антипсихотических средств и основными сердечно- и цереброваскулярными событиями: случай / не случайное исследование с использованием VigiBase

https://doi.org/10.1016/j.euroneuro.2020.03.022Get права и контент

Основные характеристики

AP с высоким сродством к Adrenergic alfa-1, Histaminic H 1 , Muscarinic M 1 и Serotoninergic 5-HT 2A были связаны с более высоким риском сообщения MACCE по сравнению с низким сродством.

Показатели MACCE могут быть связаны с антагонизмом этих рецепторов, так как зипразидон, оланзапин и клозапин показали самые высокие ROR.

AP с более высоким риском MSE были связаны с более высоким риском сообщения о MACCE по сравнению с более низким риском.

Abstract

Антипсихотики (AP) были связаны с серьезными неблагоприятными сердечно- и цереброваскулярными событиями (MACCE), но лежащие в основе механизмы неясны.Наша цель состояла в том, чтобы выяснить связь между AP, стратифицированными по сродству к рецепторам и метаболическим побочным эффектам (MSE), в отчете MACCE. Исследование случая / отсутствия случая было проведено с использованием данных из глобальной базы данных отчетов о безопасности индивидуальных случаев (ICSR) ВОЗ, VigiBase, среди всех отчетов, связанных с AP. Случаи относились к ICSR MACCE, в то время как несоблюдения относились ко всем другим побочным реакциям на лекарственные средства (ADR). AP были классифицированы по группе AP, степени сродства рецептора к адренергическим, дофаминергическим, мускариновым, гистаминовым и серотонинергическим рецепторам и по профилю MSE.Сила связи оценивалась с помощью логистической регрессии и выражалась как грубые и скорректированные отношения шансов отчетности (ROR прил. ) с соответствующими 95% доверительными интервалами (95% доверительный интервал). Мы обнаружили 4987 сообщений о MACCE и 328 907 сообщений о других ADR. Атипичные ПД (ROR прил. 2,46; 95% ДИ 2,20–2,74) были значительно связаны с сообщением о MACCE по сравнению с типичными. ПД с высоким сродством к Adrenergic alfa-1 (ROR прил. 2,98; 95% ДИ 1.93–4,59), гистаминовый H 1 (ROR с поправкой 2,31; 95% ДИ 1,98–2,68), мускариновый M 1 (с поправкой на ROR 1,87; 95% ДИ 1,74–2,01) и серотонинергический 5 -HT 2A (ROR прил. 3,19; 95% ДИ 2,07–4,92) были связаны с более высоким риском сообщения о MACCE по сравнению с низким сродством. ПД с более высоким риском MSE были связаны с более высоким риском сообщения о MACCE (ROR с поправкой 1,88; 95% ДИ 1,73–2,05) по сравнению с пациентами с более низким риском. AP с высоким сродством к адренергическим рецепторам альфа-1, гистаминовым H 1 , мускариновым M 1 и серотонинергическим рецепторам 5-HT 2A и с высоким риском МСЭ могут объяснить возникновение этих событий.

Ключевые слова

Антипсихотические препараты

Фармаконадзор

Фармакоэпидемиология

Серьезные неблагоприятные сердечно- и цереброваскулярные события

Рекомендуемые статьиЦитирующие статьи (0)

Полный текст

© 2020 Elsevier B.V. and ECNP. Все права защищены.

Рекомендуемые статьи

Ссылки на статьи

Связь между иммунными побочными эффектами во время терапии анти-PD-1 и мутационным бременем опухоли | Клиническая фармация и фармакология | JAMA Онкология

Ингибиторы иммунных контрольных точек (ICI), которые нацелены на рецептор запрограммированной смерти 1 (терапия против запрограммированной смерти 1 [PD-1]), открыли новую эру терапии рака.Однако их применение было ограничено серьезными иммунными побочными эффектами (ИРЯ), такими как колит, пневмонит и миокардит, которые остаются в значительной степени непредсказуемыми. Хотя использование бремени мутаций опухоли (TMB) в качестве биомаркера ожидаемого терапевтического ответа было рекомендовано, 1 аналогичный параметр для irAE отсутствует. Пытаясь восполнить этот клинически значимый пробел в знаниях, мы исследовали связь между ирАЭ, о которых сообщалось во время терапии анти – PD-1, и ТМВ, сравнивая данные крупномасштабного наблюдения по ИРП со средним ТМВ для нескольких типов рака.

Мы получили постмаркетинговые данные о нежелательных явлениях из Системы отчетности о нежелательных явлениях Управления по контролю за продуктами и лекарствами США (FAERS) с 1 июля 2014 г. по 31 марта 2019 г. В соответствии с политикой комитета по этике EKOS (Ethikkommission Ostschweiz, Швейцария), это исследование было исключено из этической экспертизы, потому что все проанализированные наборы данных деидентифицированы и общедоступны. Мы рассмотрели только те сообщения, в которых анти-PD-1 агенты ниволумаб или пембролизумаб предполагались причиной нежелательных явлений.Комбинированное лечение анти-PD-1 и антицитотоксического Т-лимфоцитов-ассоциированного протеина 4 было исключено. Тесно связанные указания были объединены в единые термины; например, «злокачественная меланома» была объединена с «меланомой». Чтобы ограничить наш анализ IRAE, мы отфильтровали термины, чтобы они соответствовали общепринятым диагнозам, которые были изложены в рецензируемых рекомендациях по ведению irAE. Медиана TMB в опухолевой ткани была получена из ранее опубликованного всеобъемлющего геномного профилирования. 2 , 3 Наконец, мы рассмотрели только те виды рака, для которых было по крайней мере 100 случаев нежелательных явлений во время терапии анти-PD-1, о которых сообщалось в FAERS.Чтобы оценить риск развития у пациента любых ирНЯ, мы оценили отношение шансов (ROR) отчетности, сравнив вероятность сообщения об этих ирАЭ, а не о других, для агентов против PD-1 с шансами для всех других препаратов в базе данных, которые представляет собой стандартную практику количественного анализа данных в FAERS и подобных базах данных. 4

Наша стратегия поиска выявила в общей сложности 47304 нежелательных явления (НЯ) у 16397 пациентов, получавших монотерапию анти-PD-1, по поводу 19 различных типов рака. Из этих пациентов у 3661 был по крайней мере 1 irAE (22,3%; 95% ДИ 21,7–23,0). Группу сравнения составили 16411749 отчетов об НЯ от 5160064 пациентов. Наш анализ выявил значительную положительную корреляцию между ROR сообщения об irAE во время терапии анти-PD-1 и соответствующим TMB для нескольких типов рака, с более высоким ROR irAE, связанным с более высоким средним числом кодирующих соматических мутаций на мегабазу ДНК. (Рисунок; коэффициент корреляции Пирсона R = 0,704; P <.001). Коэффициент корреляции предполагает, что 50% различий в риске ирАЭ для разных типов рака могут быть отнесены на счет TMB.

Наш анализ показывает, что раковые заболевания с высоким уровнем TMB, такие как меланома и немелкоклеточный рак легких, связаны с более высоким ROR irAE во время терапии анти-PD-1, что убедительно свидетельствует о том, что эти виды рака связаны с более высоким риском irAEs чем рак с низким TMB. Возможным объяснением этого открытия может быть различная неоантигенная нагрузка для разных типов рака. Кроме того, исследования показали, что Т-клетки, которые реагируют против неоантигена, могут перекрестно реагировать с соответствующим белком дикого типа. 5 Другой способствующий механизмом может быть распространение антигена, когда смерть опухолевых клеток высвобождает антигены, в том числе неоантигены, которые активируют лимфоциты против антигенов дикого типа в здоровой ткани. Учитывая результаты анализа, мы предполагаем, что связь между irAEs и улучшенным ответом на лечение анти-PD-1 связана с лежащим в основе неоантигенным потенциалом, который проистекает из высокого TMB.Ограничением исследования является использование спонтанных отчетов для косвенного измерения риска ирАЭ. Кроме того, пациенты с онкологическими заболеваниями с высоким уровнем TMB могут получать более длительный курс лечения анти-PD-1. Однако большинство ирАЭ, о которых сообщалось во время терапии анти-PD-1, развиваются в течение первых нескольких недель лечения. 6 Это открытие предполагает, что продолжительность терапии вряд ли повлияет на статистический результат. В заключение, высокий TMB может быть полезным биомаркером для оценки риска развития ирАЭ у пациентов во время терапии анти-PD-1, что особенно важно для уязвимых групп пациентов.

Принято к публикации: 9 июня 2019 г.

Опубликовано в Интернете: 22 августа 2019 г. doi: 10.1001 / jamaoncol.2019.3221

Открытый доступ: Это статья в открытом доступе, распространяемая в соответствии с условиями Лицензия CC-BY. © 2019 Bomze D et al. JAMA Онкология .

Автор для переписки: Лукас Флатц, доктор медицинских наук, Институт иммунобиологии, Кантонская больница Санкт-Галлен, Роршахер-штрассе 95, 9007 Санкт-Галлен, Швейцария ([email protected]).

Вклад авторов: Все авторы имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Г-н Бомзе и д-р Хасан Али внесли равный вклад как соавторы.

Концепция и дизайн кабинета: Бомзе, Хасан Али, Флатц.

Сбор, анализ или интерпретация данных: Все авторы.

Составление рукописи: Бомзе, Хасан Али, Бате.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Все авторы.

Статистический анализ: Бомзе, Бате.

Получено финансирование: Flatz.

Административная, техническая или материальная поддержка: Хасан Али, Бате.

Научный руководитель: Бате, Флатц.

Раскрытие информации о конфликте интересов: Г-н Бейт является сотрудником Pfizer; эта работа проводилась вне его служебных обязанностей, и содержание этого документа отражает его личное мнение.Доктор Флатц сообщает о грантах Швейцарского национального научного фонда, Швейцарской онкологической лиги, Hookipa Pharma, Krebsliga Schweiz и Novartis Foundation, а также о консультативной роли Novartis и Bristol-Myers Squibb. О других раскрытиях информации не сообщалось.

Финансирование / поддержка: Финансовая поддержка для этого исследования была получена от Швейцарского национального научного фонда (PP00P3_157448) (д-р Flatz).

Роль спонсора / спонсора : Спонсор не участвовал в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

6. Мартинс Ф, София L, Сикиотис GP, и другие. Неблагоприятные эффекты ингибиторов иммунных контрольных точек: эпидемиология, лечение и наблюдение [опубликовано в Интернете 15 мая 2019 г.]. Нат Рев Клин Онкол . 2019. doi: 10.1038 / s41571-019-0218-0PubMedGoogle Scholar

Отличительные функции и прогностические значения ROR при раке желудка

Орфанные рецепторы (ROR), связанные с рецепторами ретиноевой кислоты, часто аномально экспрессируются при некоторых злокачественных новообразованиях человека, включая рак желудка (GC). ROR участвуют в развитии и прогрессировании GC через рецепторы сигнального пути Wnt и другие общие рецепторы. Однако прогностическая роль отдельных ROR у пациентов с GC остается неуловимой. Мы получили доступ к прогностическим ролям трех ROR (RORα, RORβ и RORγ) через базу данных «плоттера Каплана-Мейера» (плоттер KM) у пациентов с GC. Для всех пациентов с GC, которые наблюдались в течение 20 лет, низкая экспрессия мРНК всех трех ROR показала значительную корреляцию с лучшими результатами.Мы также получили доступ к прогностической ценности отдельных ROR при различных клинических патологических характеристиках, включая классификацию Лорен, клинические стадии, патологические степени, статус HER2 и различные методы лечения. ROR продемонстрировали критическую прогностическую роль в GC. Экспрессия ROR была выше в тканях GC по сравнению с нормальными тканями желудка. Более того, нокдаун RORs значительно ингибирует пролиферацию и миграцию клеток, подтверждая онкогенную роль ROR в человеческих GC. Эти данные предполагают потенциальную роль ROR как биомаркеров прогноза GC и как онкогенов при GC.

3 Результаты

3.1 Высокая экспрессия ROR с плохим прогнозом у человека GC

Мы исследовали прогностическое значение экспрессии мРНК ROR на сайте www.kmplot.com. Действительные идентификаторы Affymetrix для RORα, RORβ и RORγ были соответственно 210479_s_at, 206443_at и 206419_at. Кривые выживаемости были построены для всех пациентов с GC ( n = 876), пациентов с GC кишечного типа ( n = 320), пациентов с GC диффузного типа ( n = 241) и пациентов со смешанным типом GC. введите GC ( n = 33).

Во-первых, мы оценили прогностическое значение экспрессии мРНК RORα через сайт www.kmplot.com. Низкая экспрессия мРНК RORα продемонстрировала связь с лучшим прогнозом [HR = 1,26, 95% CI: (1,05–1,5), P = 0,011] (Рисунок 2a). Низкая мРНК RORα также была связана с лучшим прогнозом при ГК кишечного типа [HR = 1,51, 95% ДИ: (1,09–2,11), P = 0,013] (рис. 2b), а также в ГК диффузного типа [ HR = 1,83, 95% ДИ: (1,3–2,59), P = 0,00045] (рисунок 2c). Однако существенной разницы в ГХ смешанного типа не было [HR = 2.69, 95% ДИ: (0,92–7,9), P = 0,061) (рис. 2d).

Рисунок 2

Определение прогностической ценности экспрессии мРНК RORα с использованием www.kmplot.com. Требуемый идентификатор Affymetrix действителен: 210479_s_at (RORα). (a) Кривые выживаемости были построены для всех пациентов с GC ( n = 876). (b) Кривые выживаемости были построены для пациентов с ГК кишечного типа ( n = 320). (c) Кривые выживаемости были построены для пациентов с ГК диффузного типа ( n = 241).(d) Кривые выживаемости были построены для пациентов со смешанным GC ( n = 33).

Затем мы проанализировали прогностическое значение экспрессии мРНК RORβ через сайт www.kmplot.com. Как показано на Рисунке 2, низкая экспрессия мРНК RORβ была связана с лучшей выживаемостью [HR = 1,83 95% ДИ: (1,51–2,23), P <0,0001] (Рисунок 3a). Низкая экспрессия мРНК RORβ также была связана с лучшей выживаемостью при ГК кишечного типа [HR = 2,3, 95% ДИ: (1,57–3,37), P <0,0001] (рис. 3b), а также при ГК диффузного типа. GC [HR = 1.59, 95% ДИ: (1,11–2,27), P = 0,01] (рис. 3c). Однако существенной разницы в GC смешанного типа не было [HR = 1,7, 95% CI: (0,54–5,37), P = 0,36) (рис. 3d).

Рисунок 3

Определение прогностической ценности экспрессии мРНК RORβ на сайте www.kmplot.com. Требуемый идентификатор Affymetrix действителен: 206443_at (RORβ). (a) Кривые выживаемости были построены для всех пациентов с GC ( n = 876). (b) Кривые выживаемости были построены для пациентов с ГК кишечного типа ( n = 320).(c) Кривые выживаемости были построены для пациентов с ГК диффузного типа ( n = 241). (d) Кривые выживаемости были построены для пациентов с ГК смешанного типа ( n = 33).

Кривые выживаемости экспрессии мРНК RORγ показаны на рисунке 4. Мы наблюдали, что низкая экспрессия мРНК RORγ была связана с лучшим прогнозом при GC [HR = 0,48, 95% CI: (1,25–1,76), P < 0,0001] (Фиг.4а). Низкая экспрессия мРНК RORγ также была связана с лучшим прогнозом при ГК кишечного типа [HR = 2.01, 95% ДИ: (1,45–2,79), P <0,0001] (рис. 4b). Однако не было существенной разницы в GC диффузного типа [HR = 0,79, 95% CI: (0,56–1,11), P = 0,18] (рис. 4c) или в GC смешанного типа [HR = 2,23, 95 % ДИ: (0,76–6,55), P = 0,13)] (рисунок 4d).

Рисунок 4

Определение прогностической ценности экспрессии мРНК RORγ с использованием www.kmplot.com. Требуемый идентификатор Affymetrix действителен: 206419_at (RORγ). (a) Кривые выживаемости были построены для всех пациентов с GC ( n = 876).(b) Кривые выживаемости были построены для пациентов с ГК кишечного типа ( n = 320). (c) Кривые выживаемости были построены для пациентов с GC ( n = 241). (d) Кривые выживаемости были построены для пациентов с ГК смешанного типа ( n = 33).

Согласно этим результатам, низкая экспрессия мРНК RORα, RORβ и RORγ были связаны с лучшим прогнозом у пациентов с GC. Хотя значительных различий в прогнозе в подгруппе ГК смешанного типа не наблюдалось, это могло быть связано с небольшой когортой, насчитывающей всего 33 случая.Затем мы проанализировали корреляцию между членами семьи ROR и прогнозом GC в отношении различных клинических патологических особенностей. Это включало сравнение клинических стадий (таблица 1), статуса HER2 (таблица 2), степени патологии (таблица 3) и различных методов лечения (таблица 4). Как показано в таблице 1, низкая экспрессия мРНК RORβ коррелировала с лучшим прогнозом на всех клинических стадиях GC [стадия 1: HR = 3,63, 95% CI: (1,35–9,75), P = 0,0063; стадия 2: HR = 2,71, 95% ДИ: (1,3–5,67), P = 0.0085; стадия 3: HR = 1,65, 95% ДИ: (1,17–2,32), P = 0,0036; стадия 4: HR = 1,61, 95% ДИ: (1,1–2,37), P = 0,014]. Низкая экспрессия мРНК RORα была связана с лучшим прогнозом на клинических стадиях 2 и 4 у пациентов с GC [стадия 2: HR = 2,13, 95% CI: (1,18–3,86), P = 0,01; стадия 4: HR = 1,99, 95% ДИ: (1,37–2,97), P = 0,00056]. Низкая экспрессия мРНК RORγ была связана с лучшим прогнозом на клинических стадиях 3 и 4 у пациентов с ГК [стадия 3: HR = 2.39, 95% ДИ: (1,65–3,45), P <0,0001; стадия 4: HR = 0,63, 95% ДИ: (0,42–0,96), P = 0,029]. Как показано в Таблице 2, низкая экспрессия мРНК RORα [HER2-отрицательный: HR = 1,51, 95% CI: (1,19–1,91), P = 0,00064; HER2 положительный: HR = 1,36, 95% ДИ: (1,04–1,79), P = 0,024] и RORβ [HER2 отрицательный: HR = 1,95, 95% ДИ: (1,51–2,51), P <0,0001; HER2-положительный: HR = 1,59 95% CI: (1,15–2,19), P = 0,0046] был связан с лучшим прогнозом как для HER2-отрицательных, так и для HER2-положительных пациентов с GC.Для сравнения, низкая экспрессия мРНК RORγ была связана только с лучшим прогнозом у HER2-отрицательных пациентов [HR = 1,55, 95% CI: (1,23–1,95), P = 0,00016]. Как показано в таблице 3, экспрессия мРНК различных ROR не коррелировала с лучшим прогнозом при патологической степени I, II или III у пациентов с GC. Наконец, как показано в Таблице 4, низкая экспрессия мРНК RORα была связана с лучшей ОС у пациентов, перенесших только операцию [HR = 2,01, 95% CI: (1,5–2,68), P <0.0001] и у 5 пациентов с адъювантом на основе ФУ [HR = 0,37, 95% ДИ: (0,24–0,57), P <0,0001]. Низкая экспрессия мРНК RORβ была связана только с лучшей ОС у пациентов, перенесших только операцию [HR = 1,5, 95% ДИ: (1,08–2,08), 0,014]. Наконец, низкая экспрессия мРНК RORγ была связана с лучшей ОС только у 5 пациентов с адъювантом на основе FU с GC [HR = 0,69, 95% CI: (0,48–0,97), 0,031].

Таблица 1

Корреляция экспрессии мРНК RORs с клиническими стадиями пациентов с ГК

–9.0063 0,6
ROR Клинические стадии Случаи HR 95% ДИ P
1 69 0. 38 0,13–1,14 0,074
2 145 2,13 1,18–3,86 0,01
3 319 1,18 4 152 1,99 1,37–2,97 0,00056
RORβ 1 69 0,363
2 145 2,71 1,3–5,67 0,0085
3 319 1,65 1,17–2,32
1,1–2,37 0,014
RORγ 1 69 2,37 0,89–6,34 0,076
145387 74 0,93–3,26 0,08
3 319 2,39 1,65–3,45 1,90 × 10 −6
4 0,029
Таблица 2

Корреляция экспрессии мРНК RORs со статусом HER 2 у пациентов с GC

ROR 155
Статус HER 2 Случаи HR
RORα Отрицательный 641 1.51 1,19–1,91 0,00064
Положительный 425 1,36 1,04–1,79 0,024
ROR7 1,90 × 10 -7
Положительный 425 1,59 1,15–2,19 0,0046
RORγ 1,23–1,95 0,00016
Положительный 425 1,26 0,94–1,7 0,12
Таблица 3

0,12 ROR Патологические степени Случаи HR 95% ДИ P RORα I 166 37 0,92–2,04 0,12 II 67 0,75 0,39–1,45 0,4 III 32 0,02 32 0,02 32 0,02 RORβ I 166 0,73 0,49–1,09 0,12 II 67 0,7 0,35–6387 0,35–1,4 0. 47 0,16–1,41 0,17 RORγ I 166 0,81 0,54–1,2 0,29 67386 903 0,063 III 32 2,6 0,76–8,87 0,11 Таблица 4

Корреляция экспрессии мРНК RORs при разных методах лечения пациентов с Лечение Случаи HR 95% ДИ P RORα Только хирургическое вмешательство 393 2.01 1,5–2,68 1,70 × 10 −6 Адъювант на основе 5-ФУ 158 0,37 0,24–0,57 3,00 × 10 −6 RORβ Только хирургическое вмешательство 393 1,5 1,08–2,08 0,014 Адъювант на основе 5-фторопласта 158 0386 1,45 0387 1,45 0387 0387 1,45 0387 RORγ Только хирургическое вмешательство 393 1. 26 0,94–1,68 0,12 Адъювант на основе 5-ФУ 158 0,69 0,48–0,97 0,031

3,2 В результате высокая экспрессия ROR представлялась плохим прогнозом при GC, поэтому мы стремились подтвердить, была ли чрезмерная экспрессия ROR в тканях GC. Дифференцированная экспрессия ROR в 60 нормальных тканях желудка и 60 тканях GC человека была обнаружена с помощью иммуногистохимии.Как показано на фиг. 5, уровни экспрессии RORα, RORβ и RORγ были повышены в тканях GC по сравнению с нормальными тканями. Высокая экспрессия RORα, RORβ и RORγ достигла уровней 64,5% (20/31), 51,6% (16/31) и 61,3% (19/31), соответственно.

Рис. 5

RORα, RORβ и RORγ были сверхэкспрессированы в тканях GC человека. (а) Уровни экспрессии RORα, RORβ и RORγ в GC и окружающих тканях определяли с помощью иммуногистохимии. Микрофотографии были сделаны при 400-кратном увеличении.(б) Анализ иммуногистохимических результатов.

3.3 Подавление экспрессии ROR блокировало пролиферацию и миграцию человеческих клеток GC

Экспрессия ROR ингибировалась специфическими siRNA (siRORα, siRORβ и siRORγ) для создания нокдаун-клеток для выяснения их биологических функций в клетках AGS (рис. 6a и b. ). Мы также обнаружили эффект нокдауна отдельного ROR на два других ROR. Результаты доказали, что экспрессия одного ROR не влияет на экспрессию других ROR (рис. 6b).Наши данные показали, что после подавления экспрессии RORα пролиферация клеток значительно подавлялась. Такие же результаты наблюдались и в клетках, в которых экспрессия RORβ или RORγ была подавлена ​​(фиг. 6c). Чтобы дополнительно продемонстрировать функцию ROR в человеческих клетках GC, был проведен анализ трансвелл. Как показано на фиг. 6d, количество мигрировавших клеток в группе siRORα, siRORβ или siRORγ было значительно снижено по сравнению с группой siNC. Согласно приведенным выше результатам, мы прогнозируем, что ROR служат онкогенами в человеческом GC.

Рисунок 6

Нокдаун RORα, RORβ или RORγ ингибировал пролиферацию и миграцию клеток. Уровни мРНК (а) и белка (b) RORα, RORβ и RORγ в NC и нокдаун-клетках определяли с помощью кПЦР и вестерн-блоттинга, соответственно. (c) Пролиферацию клеток с трансфекцией siNC, siRORα, siRORβ или siRORγ подтверждали с помощью анализа CCK-8. (d) Миграцию клеток с трансфекцией siNC, siRORα, siRORβ или siRORγ детектировали с помощью трансвелл. * P <0,05.

4 Обсуждение

Ядерные рецепторы представляют собой класс лиганд-зависимых рецепторов, которые принадлежат к суперсемейству факторов транскрипции, которые аналогичны рецепторам стероидных гормонов.Это семейство широко распространено в организме человека и играет важную роль в развитии клеток, дифференцировке клеток, физиологическом ритме, метаболизме и иммунной регуляции. Ядерные рецепторы имеют три подсемейства, состоящие из рецепторов стероидных гормонов, рецепторов нестероидных гормонов и орфанных ядерных рецепторов [18]. ROR являются важными членами подсемейства орфанных ядерных рецепторов. Их также называют NR1F из-за гомологии с рецептором ретиноевой кислоты семейства стероидных рецепторов [19].

Ген RORα, расположенный на хромосоме 15q22.2, содержит 15 экзонов и охватывает примерно 730 т.п.н. геномных областей. Он выполняет множество важных физиологических функций в организмах. Дефекты RORα у мышей могут привести к ряду аномалий. Эти нарушения могут включать нарушение формирования костей и атрофию мышц, атаксию и атрофию мозжечка, уменьшение размеров селезенки и тимуса, нарушения циркадного ритма и нарушение липидного обмена [20,21]. Функциональный анализ показал, что аномальная экспрессия RORα связана со многими заболеваниями и развитием опухолей.RORα может регулировать экспрессию некоторых генов, связанных с опухолью (таких как nm23 и N-Myc), а также может ингибировать развитие опухоли путем ингибирования пути передачи сигнала Wnt / β-catenin [22,23]. В опухолях молочной железы RORα подавляет прогрессирование опухоли, индуцируя поляризацию клеток и ингибируя инвазию клеток, что обеспечивает потенциальную терапевтическую мишень для рака груди [24]. Исследования рака толстой кишки определили, что Wnt5a / PKCα-зависимое фосфорилирование серинового остатка 35 RORα имеет решающее значение для связи RORα с передачей сигналов Wnt / β-catenin.Это проявляет ингибирующие функции экспрессии генов-мишеней Wnt / β-catenin и предоставляет доказательства роли RORα между каноническим и неканоническим путями передачи сигналов Wnt [23]. RORα также изучался в GC. Положительная экспрессия RORα при карциноме желудка была значительно ниже, чем у сопоставимой нераковой слизистой оболочки и парараковой ткани. Более того, доля хорошо дифференцированной ткани карциномы желудка была выше, чем доля плохо дифференцированной ткани карциномы желудка [25].Однако Bie et al. недавно было установлено, что уровни экспрессии мРНК RORα у пациентов с GC были выше по сравнению со здоровым контролем в мононуклеарных клетках периферической крови (PBMC) [26]. В нашем исследовании низкая экспрессия мРНК RORα коррелировала с лучшим прогнозом у пациентов с GC, включая кишечных и пациентов с GC диффузного типа. Кроме того, RORα можно коррелировать с прогнозом на основании различных клинических характеристик, включая статус HER2, клинические стадии 2 и 4 и различные методы лечения.В соответствии с предыдущими результатами, было обнаружено, что RORα активируется в опухолевых тканях, и его подавление ингибирует рост клеток в клетках GC. Все вышеперечисленные результаты предполагают, что может быть несколько ролей RORα в GC. RORα может участвовать в развитии GC, воздействуя на различные опухолевые молекулы или сигнальные пути.

RORβ был первоначально идентифицирован как член семейства орфанных ядерных рецепторов Карлбергом в 1994 году. Этот ген, расположенный на хромосоме 9q21.13, содержит 10 экзонов и охватывает 188 т.п.н. геномных областей [27].RORβ играет важную роль в развитии многих физиологических процессов и заболеваний. Он может способствовать пролиферации и дифференцировке палочек сетчатки, горизонтальных клеток и амакриновых клеток [28]. Кроме того, он может служить типом остеогенного ингибитора в процессе формирования костей, подавляя дифференцировку костей, и играет важную роль в регуляции физиологического ритма [29,30]. Роль RORβ в опухолях также изучалась [31]. Райзингер и др. использовали микроматрицы олигонуклеотидов для оценки профиля экспрессии транскрипта в эпителиальных железистых клетках.Клетки были подвергнуты лазерной микродиссекции из 79 эндометриоидных и 12 серозных стадий I рака эндометрия с гетерогенным распределением степени и глубины инвазии миометрия, а также из 12 нормальных образцов эндометрия в постменопаузе. Они обнаружили значительно низкую экспрессию RORβ при эндометриоидном и серозном раке эндометрия по сравнению с высокой экспрессией в нормальных образцах эндометрия в постменопаузе [32]. Интересно, что Дэвидсон и др. продемонстрировали, что уровень экспрессии RORβ повышается при первичной лейомиосаркоме матки [33].Матиевич и Павелич обнаружили, что стимуляция toll-подобного рецептора 3 (TLR3) ингибирует экспрессию RORβ в линии метастатических клеток глотки Detroit 562, а ингибирование TLR3 приводит к усилению регуляции RORβ. Это предполагает, что экспрессия RORβ зависит от экспрессии TLR3 [34]. В недавних исследованиях RORβ был ключевой мишенью, с помощью которой белок 2, взаимодействующий с ядерным рецептором (NRIP2), регулировал активность пути Wnt в обогащенных клетках колоректального рака. NRIP2 не способен активировать путь Wnt после нокдауна RORβ, что указывает на то, что RORβ также является ингибитором пути Wnt [35].Однако RORβ не изучался в GC. Несмотря на кривую выживаемости, наше исследование определило, что низкая экспрессия мРНК RORβ коррелирует с лучшим прогнозом у пациентов с GC, включая кишечные и диффузные подтипы GC. Кроме того, RORβ продемонстрировал корреляцию, основанную на различных клинических характеристиках, включая статус HER2, клинические стадии 1–4 и лечение только хирургическим вмешательством. Более того, в тканях GC наблюдалась сверхэкспрессия RORβ, и его ингибирование блокировало пролиферацию и миграцию клеток AGS.Наши результаты показывают, что RORβ связан с прогнозом GC как онкогена, но его специфический механизм при GC требует дальнейших исследований.

Кодирующий ген RORγ расположен на хромосоме 1 человека и состоит из 10 экзонов. RORγ в основном экспрессируется в тканях иммунной системы, таких как тимус. Однако он также экспрессируется в печени, скелетных мышцах, жировой ткани и почках. Он играет важную роль в секреции IL-17 и других провоспалительных факторов в клетках Th27 [36].Ингибируя активность Th27, RORγ может подавлять экспрессию IL-17, поддерживая баланс между Th27 и Treg-клетками, что может уменьшить возникновение воспалительных реакций. RORγ является важным фактором транскрипции, который регулирует развитие и функцию CD4-позитивных Th27 и CD8-позитивных Tc17 лимфоцитов. Около 15% опухолей, инфильтрирующих лимфоциты, экспрессируют RORγ [37]. В клетках GC SGC-7901 человека siRNA-RORγ эффективно блокирует экспрессию SUMO-специфической протеазы 1 (SENP1), индуцируемого гипоксией фактора-1α (HIF-1α) и продукцию фактора роста эндотелия сосудов (VEGF) в условиях гипоксии.Это указывает на роль ядерного рецептора RORγ в подавлении мелатонином накопления HIF-1α и VEGF [38]. В нашем исследовании мы определили, что низкая экспрессия мРНК RORγ коррелирует с лучшим прогнозом при GC, включая кишечные и диффузные подтипы GC. Кроме того, RORγ продемонстрировал корреляции, основанные на различных клинических признаках, включая HER2-отрицательные, клинические стадии 3 и 4 и адъювантную терапию на основе 5-FU. Наши результаты показывают, что RORγ связан с прогнозом GC.Особая роль RORγ делает его очень ценной лекарственной мишенью [39]. Несколько фармацевтических компаний и исследовательских институтов, таких как GlaxoSmithKline (GSK) и Scripps Institute, провели исследования низкомолекулярных лигандов, нацеленных на ROR [40,41]. Следовательно, ROR могут способствовать прогрессированию опухоли, воздействуя на сигнальные пути Wnt и VEGF и экспрессию белка ниже по течению. В будущем мы сосредоточимся на регуляции RORs на экспрессии генов, связанных с пролиферацией, метастазированием и апоптозом клеток, а также на влиянии на пути передачи сигналов Wnt и VEGF.Кроме того, учитывая взаимодействие между ROR, необходимо изучить синергетический эффект двух или трех ROR. Однако из-за ограничений онлайн-анализа нам необходимо собрать клинические организации в местных больницах для исследований, которые также будут в центре внимания наших дальнейших исследований.

В заключение, уровни экспрессии RORα, RORβ и RORγ коррелировали с прогнозом GC. Низкая экспрессия мРНК ROR указывает на лучшую ОС на основе существующих патологических образцов.RORs были активированы в тканях GC, и их нокдаун ингибировал пролиферацию и миграцию клеток GC. Следовательно, необходимо расширить размер выборки для изучения прогностической ценности ROR и изучения конкретных путей ROR и их роли in vivo . Эти данные свидетельствуют о том, что все три подсемейства ROR играют важную роль в развитии GC и имеют потенциал в качестве противоопухолевых добавок. Это дает новые идеи и подходы к лечению GC.

Ссылки

[1] Джемал А., Брей Ф, Центр М.М., Ферли Дж., Лорте-Тайулент Дж., Джемаль А.Глобальная статистика рака. CA Cancer J Clin. 2015; 65 (2): 87. Искать в Google Scholar

[2] Alberts SR, Cervantes A, van de Velde CJ. Рак желудка: эпидемиология, патология и лечение. Энн Онкол. 2003. 14 (Дополнение 2): 31–6. Искать в Google Scholar

[3] Choi YY, Noh SH, Cheong JH. Эволюция лечения рака желудка: от золотого века хирургии до эпохи точной медицины. Йонсей Мед Дж. 2015; 56 (5): 1177–85. Искать в Google Scholar

[4] Chang HM, Lee SW, Nomura E, Ahn SH, Park DJ, Kim HH.Сравнение лапароскопической и открытой гастрэктомии у больных раком желудка с ХОБЛ. J Surg Oncol. 2014; 155 (1): 154–64. Искать в Google Scholar

[5] Лян Л., Фанг Дж.Й., Сюй Дж. Рак желудка и вариация числа копий гена: новые факторы рака для таргетной терапии. Онкоген. 2016; 35 (12): 1475. Искать в Google Scholar

[6] Линь И, Ву З, Го У. Генные мутации при раке желудка: обзор недавних исследований секвенирования следующего поколения. Tumor Biol. 2015; 36 (10): 7385. Искать в Google Scholar

[7] Solt LA, Burris TP.Действие ROR и их лигандов в (пато) физиологии. Trends Endocrinol Metab. 2012; 23 (12): 619. Искать в Google Scholar

[8] Solt LA, Kojetin DJ, Burris TP. REV-ERB и ROR: молекулярные связи между циркадными ритмами и гомеостазом липидов. Future Med Chem. 2011; 3 (5): 623–38. Искать в Google Scholar

[9] Като М. Сигнальный путь WNT / PCP и рак человека (обзор). Онкол Реп.2005; 14 (6): 1583. Искать в Google Scholar

[10] Йошида Н., Кинугаса Т., Миёси Х., Сато К., Юге К., Охчи Т. и др.Высокое соотношение RORγT / CD3 является сильным прогностическим фактором послеоперационной выживаемости при распространенном колоректальном раке: анализ хелперных Т-лимфоцитов (Th2, Th3, Th27 и регуляторных Т-клеток). Энн Сург Онкол. 2016; 23 (3): 919–27. Искать в Google Scholar

[11] Генри CE, Llamosas E, Djordjevic A, Hacker NF, Ford CE. Миграция и инвазия подавляются подавлением ROR1 и ROR2 при химиорезистентном раке яичников. Онкогенез. 2016; 5 (5): e226. Искать в Google Scholar

[12] Wu X, Liu W, Tang D, Xiao H, Wu Z, Chen C, et al.Прогностические значения экспрессии мРНК четырех рецепторов Notch при раке желудка. Научный отчет 2016; 6: 28044. Искать в Google Scholar

[13] Zhang S, Zhen W, Liu W, Lei R, Shan J, Li L, et al. Четкие прогностические значения экспрессии мРНК S100 при раке молочной железы. Научный доклад 2017; 7: 39786. Искать в Google Scholar

[14] Wu S, Xue W, Huang X, Yu X, Luo M, Huang Y, et al. Различное прогностическое значение изоферментов ALDh2 при раке молочной железы. Tumor Biol. 2015; 36 (4): 2421–6. Искать в Google Scholar

[15] Zhou X, Teng L, Wang M.Четкие прогностические значения экспрессии мРНК четырех Notch-рецепторов при раке яичников. Tumor Biol. 2016; 37 (5): 6979–85. Искать в Google Scholar

[16] Иванова Л., Зандберга Э., Силиня К., Калниня З., bols A, Endzeliš E, et al. Прогностическая значимость экспрессии карбоангидразы IX различна для различных подтипов рака молочной железы, и ее подавление подавляет способность клеток рака молочной железы к самообновлению. Cancer Chemother Pharmacol. 2015; 75 (2): 235–46. Искать в Google Scholar

[17] Györffy B, Surowiak P, Budczies J, Lánczky A.Программное обеспечение для онлайн-анализа выживаемости для оценки прогностической ценности биомаркеров с использованием транскриптомных данных при немелкоклеточном раке легкого. PLoS One. 2013; 8 (12): e82241. Искать в Google Scholar

[18] Green S, Chambon P. Ядерные рецепторы улучшают наше понимание регуляции транскрипции. Тенденции Genet. 1988; 4 (11): 309. Искать в Google Scholar

[19] Петкович М., Брэнд Н.Дж., Краст А., Шамбон П. Рецептор ретиноевой кислоты человека, принадлежащий к семейству ядерных рецепторов. Природа.1987. 330 (6147): 444–50. Искать в Google Scholar

[20] Джеттен AM, Hong SK, Takeda Y. Орфанные рецепторы α и γ, связанные с ретиноевой кислотой: ключевые регуляторы метаболизма липидов / глюкозы, воспаления и чувствительности к инсулину. Фронт-эндокринол (Лозанна). 2013; 4: 1. Искать в Google Scholar

[21] Хэ Б, Чжао И, Сюй Л., Гао Л., Су И, Линь Н. и др. Рецептор ядерного мелатонина RORα представляет собой новый эндогенный защитник от ишемии / реперфузионного повреждения миокарда. J Pineal Res. 2016; 60 (3): 313–26.Искать в Google Scholar

[22] Ройманс Д., Виллемс Р., Блокстале DRV, Слегерс Х. Нуклеозиддифосфаткиназа (NDPK / NM23) и вальс с множеством партнеров: возможные последствия при метастазировании опухоли. Clin Exp Metastasis. 2002. 19 (6): 465–76. Искать в Google Scholar

[23] Джи М.Л., Ким И.С., Ким Х., Ли Дж.С., Ким К., Йим Х.Й. и др. RORα ослабляет передачу сигналов Wnt / β-катенина посредством PKCα-зависимого фосфорилирования при раке толстой кишки. Mol Cell. 2010. 37 (2): 183–95. Искать в Google Scholar

[24] Xiong GF, Xu R.Abstract 2701: RORα подавляет прогрессирование опухоли молочной железы, индуцируя поляризацию клеток и ингибируя инвазию клеток. Cancer Res. 2012; 72: 2701. Искать в Google Scholar

[25] Shi Y, Huang JJ, Jian SU, et al. Экспрессия RORα при раке желудка и клиническое патологическое значение. Подбородок J Clin Exp Pathol. 2012. 28 (3): 270–73. Искать в Google Scholar

[26] Би Кью, Юмин У, Ян Х и др. Выявление факторов, связанных с нооцитами, в периферической крови больных раком желудка и его иммунопатологическое значение.Immunol J. 2014; 30 (1): 41–4. Искать в Google Scholar

[27] Карлберг К., Визенберг И. Семейство сирот RZR / ROR, мелатонин и липоксигеназа: неожиданная взаимосвязь. J Pineal Res. 1995. 18 (4): 171–8. Искать в Google Scholar

[28] Лю Х, Ким СИ, Фу И, Ву Х, Нг Л, Сваруп А. и др. Изоформа ретиноидного орфанного рецептора β управляет дифференцировкой амакрина сетчатки и горизонтальных интернейронов. Nat Commun. 2013; 4: 1813. Искать в Google Scholar

[29] Mühlbauer E, Bazwinsky-Wutschke I, Wolgast S, Labucay K, Peschke E.Дифференциальная и зависимая от времени суток экспрессия ядерных рецепторов RORα, RORβ, RORγ и RXRα в поджелудочной железе и островке грызунов. Mol Cell Endocrinol. 2013; 365 (2): 129–38. Искать в Google Scholar

[30] Jabaudon D, Shnider SJ, Tischfield DJ, Galazo MJ, Macklis JD. RORβ индуцирует бочкообразные нейрональные кластеры в развивающемся неокортексе. Cereb Cortex. 2012. 22 (5): 996–1006. Искать в Google Scholar

[31] Фэн С., Сюй С, Вэнь З, Чжу Ю. Орфанный рецептор RORβ, связанный с ретиноевой кислотой, аномалии циркадного ритма и онкогенез (обзор).Int J Mol Med. 2015; 35 (6): 1493–500. Поиск в Google Scholar

[32] Райзингер Дж. И., Аллард Дж., Чандран У., Дэй Р., Чандрамули Г. В., Миллер С. и др. Анализ экспрессии генов на ранних стадиях рака эндометрия выявляет уникальные транскрипты, связанные со степенью и гистологией, но не глубиной инвазии. Фасад Онкол. 2013; 3: 139. Искать в Google Scholar

[33] Дэвидсон Б., Абелер В.М., Фёрсунд М., Холт А., Ян Й., Кобаяши Ю. и др. Сигнатуры экспрессии генов первичной и метастатической лейомиосаркомы матки.Human Pathol. 2013. 45 (4): 691–700. Искать в Google Scholar

[34] Матиевич Т., Павелич Дж. Двойная роль TLR3 в линии метастатических клеток. Clin Exp Metastasis. 2011; 28 (7): 701. Искать в Google Scholar

[35] Вен З, Пан Т., Ян С., Лю Дж, Тао Х, Чжао Й и др. Активная регуляция NRIP2 в клетках, инициирующих колоректальный рак, модулирует путь Wnt, воздействуя на RORβ. Молочный рак. 2017; 16 (1): 20. Искать в Google Scholar

[36] Ху X, Ван Y, Hao LY, Liu X, Lesch CA, Sanchez BM, et al.Исправление: метаболизм стеролов контролирует дифференцировку Th27 за счет выработки эндогенных агонистов RORγ. Nat Chem Biol. 2015; 11 (2): 141. Поиск в Google Scholar

[37] Тейлор П.Р., Рой С.М., Лил С.М., Сан Й., Хауэлл С.Дж., Кобб Б.А. и др. Активация нейтрофилов аутокринными взаимодействиями IL-17A-IL-17RC во время грибковой инфекции регулируется IL-6, IL-23, RORγt и дектином-2. Nat Immunol. 2015; 16: 214. Искать в Google Scholar

[38] Wang RX, Liu H, Xu L, Zhang H, Zhou RX. Участие ядерного рецептора RZR / RORγ в индуцированной мелатонином инактивации HIF-1α в клетках рака желудка человека SGC-7901.Онкол Реп.2015; 34 (5): 2541. Искать в Google Scholar

[39] Марчиано Д., Чанг М.Р., Корсо К., Госвами Д., Лам В.К., Паскаль Б.Д. и др. Терапевтический потенциал модуляторов ядерных рецепторов для лечения метаболических нарушений: PPARγ, ROR и обратные глаголы. Cell Metab. 2014. 19 (2): 193–208. Искать в Google Scholar

[40] Zhang W, Zhang J, Fang L, Zhou L, Wang S, Xiang Z и др. Повышение дифференцировки Th27 человека посредством активации орфанного рецептора ретиноидной кислоты, родственного орфанному рецептору γ (RORγ), классом ариламидных соединений.Mol Pharmacol. 2012; 82 (4): 583. Искать в Google Scholar

[41] Ван И, Кумар Н., Солт Л.А., Ричардсон Т.И., Хелверинг Л.М., Крамбли С. и др. Модуляция альфа- и гамма-активности орфанных рецепторов ретиноевой кислоты с помощью 7-оксигенированных стериновых лигандов. J Biol Chem. 2010; 285 (7): 5013. Искать в Google Scholar

Регулирование гидроксистероидной сульфотрансферазы человека (SULT2A1) с помощью RORα и RORγ и его потенциальное значение для заболеваний печени человека | Молекулярная эндокринология

Было постулировано, что ретиноидные орфанные рецепторы (ROR) выполняют функции в развитии тканей и циркадном ритме.В этом исследовании мы выявили новую функцию RORα (NR1F1) и RORγ (NR1F3) в регулировании гидроксистероид-сульфотрансферазы человека ( SULT2A1 ), фермента, конъюгирующего фазу II, известного как сульфонат желчных кислот, гидроксистероид-дегидроэпиандростерон и родственный андростерон. Комбинация анализа промоторного репортерного гена и анализов EMSA и иммунопреципитации хроматина (ChIP) показала, что как RORα, так и RORγ трансактивировали промотор гена SULT2A1 посредством их связывания с элементом ответа ROR, обнаруженным в промоторе гена SULT2A1 .Интересно, что этот элемент ответа ROR перекрывается с ранее описанным конститутивным элементом ответа рецептора андростана на том же промоторе. Подавление RORα и / или RORγ малыми интерферирующими РНК подавляло экспрессию эндогенного SULT2A1 . В первичных гепатоцитах человека и печени человека мы обнаружили положительную корреляцию между экспрессией SULT2A1 и ROR , что дополнительно поддерживало регуляцию SULT2A1 с помощью ROR. Мы также обнаружили, что экспрессия RORα и RORγ нарушалась при нескольких заболеваниях печени, таких как стеатоз / стеатогепатит, фиброз и гепатоцеллюлярная карцинома.Положительная регуляция человеческого SULT2A1 с помощью ROR противоположна отрицательной регуляции Sult2a1 с помощью ROR у грызунов. Таким образом, наши результаты установили, что SULT2A1 является новым геном-мишенью ROR. Экспрессия ROR является потенциальным предиктором экспрессии SULT2A1, а также болезненных состояний.

Подсемейство ретиноидных орфанных рецепторов (ROR), включая изоформы RORα (NR1F1), RORβ (NR1F2) и RORγ (NR1F3), были выделены на основании их гомологии с рецепторами ретиноидов (1).Каждая из трех изоформ ROR демонстрирует уникальные паттерны распределения в тканях (2). RORα широко распространен (3, 4). RORβ, с другой стороны, демонстрирует более ограниченную тканями экспрессию в головном мозге, сетчатке и шишковидной железе (1, 5). RORγ сильно экспрессируется в тимусе, но также обнаруживается в почках, печени и мышцах (1, 6).

ROR регулируют экспрессию генов-мишеней, в основном за счет их связывания в качестве мономеров с элементами ответа ROR (RORE), обнаруженными в промоторах генов-мишеней. Типичный RORE состоит из консенсусной половины сайта AGGTCA, которой предшествует A / T-богатая область (7).Также было показано, что RORα связывается с промотором-мишенью в виде гомодимеров (8). Ранняя функциональная характеристика RORs в основном полагалась на исследования мышей с дефицитом ROR из-за отсутствия функциональных лигандов. Мыши ROR α — / — , которые несли естественную делецию в лиганд-связывающем домене гена ROR α, приводящую к сдвигу рамки считывания (3, 4), имели фенотип мозжечковой атаксии, который также можно было наблюдать. у мутантных мышей Staggerer ( sg / sg ).Сосудистая дисфункция, мышечные нарушения, остеопороз, иммунные нарушения и сенсибилизация к атеросклерозу, вызванному диетой, наблюдались у мышей sg / sg (9, 10). Мыши ROR β — / — показали отличительные фенотипы в циркадном поведении и дегенерации сетчатки (11). У мышей ROR γ — / — обнаружены дефекты лимфоидного органогенеза и тимопоэза (12). В последние годы был достигнут значительный прогресс в идентификации, разработке и характеристике лигандов ROR (13-15), что облегчило функциональную характеристику RORs.Недавно было показано, что SR1001, синтетический антагонист RORα и RORγ, подавляет дифференцировку Th27 и аутоиммунитет (15).

Хотя и RORα, и RORγ экспрессируются в печени, их печеночная функция не была оценена до недавнего времени. Потеря RORα и / или RORγ у мышей влияла на экспрессию нескольких печеночных ферментов фазы I и фазы II, метаболизирующих лекарственные средства (16). Было показано, что RORα и RORγ непосредственно регулируют ферменты печеночного цитохрома P450 оксистерин-7α-гидроксилазу ( CYP7B1 ) (17) и CYP2C8 (18).Сульфотрансферазы (SULT) принадлежат к семейству ферментов фазы II, метаболизирующих лекарственные средства, которые катализируют сульфирование гидроксилсодержащих соединений, включая эндогенные и экзогенные молекулы. SULT2A1, член подсемейства гидроксистероидов SULT (19), высоко экспрессируется в печени и надпочечниках. Типичные субстраты для SULT2A1 включают желчные кислоты (20), гидроксистероид дегидроэпиандростерон (DHEA) (21) и родственные андрогены. Было показано, что SULT2A1-опосредованное сульфирование желчных кислот, по крайней мере, у грызунов, играет важную роль в детоксикации желчных кислот и предотвращении холестаза.Экспрессия SULT2A1 транскрипционно регулируется ядерными рецепторами, такими как рецептор прегнана X (PXR) (22), конститутивный рецептор андростана (CAR) (23), рецептор X печени (LXR) -α (24), ядерный фактор гепатоцитов. -4 (25), рецептор фарнезоида X (26) и рецептор эстрогена-α (27). Активация SULT2A1 с помощью PXR, CAR и LXRα, как было постулировано, играет важную роль в антихолестатической активности этих рецепторов в моделях холестаза у грызунов (22-24).Экспрессия мыши Sult2a1 была повышена у мышей, у которых отсутствовали RORα и / или RORγ, тогда как сверхэкспрессия дикого типа или конститутивно активированная RORα в печени подавляла экспрессию Sult2a1 (16), что позволяет предположить, что мышь Sult2a1 отрицательно регулируется нормами дохода. Однако механизм отрицательной регуляции Sult2a1 с помощью RORs не был понят (16). Не было информации о том, регулируется ли человеческий SULT2A1 с помощью ROR.

В текущем исследовании мы показали, что ROR положительно и прямо регулируют экспрессию гена SULT2A1 человека, что противоположно отрицательной регуляции Sult2a1 с помощью ROR у грызунов. Регулирование SULT2A1 с помощью ROR подтверждается положительной ассоциацией между SULT2A1 и ROR в первичных гепатоцитах человека и печени человека. Наши результаты также предполагают, что экспрессия ROR может быть нарушена при заболеваниях печени.

Материалы и методы

Плазмидные конструкции

Репортер промотора pGL3-SULT2A1 клонировали с помощью ПЦР с использованием следующих праймеров: прямого, 5′-CGCGAGCTCTGAGAACAGATAAAGACTGT-3 ‘и обратного, 5′-CCGCTCGAGGTGGTGTGAGGGTTTCAACTG-3’, используя геномную матрицу плаценты человека. Продукты ПЦР расщепляли Sac I и Xho I и вставляли в тот же ферментативный расщепленный pGL3-базовый вектор от Promega (Мэдисон, Висконсин).Репортеры промотора SULT2A1 длиной 500 п.н., несущие элемент ответа CAR (CARE), половину сайта, который является общим для связывающих элементов CAR и ROR (CORE), или мутации RORE были созданы с помощью сайт-направленного мутагенеза с использованием следующих праймеров: мутант CARE, 5 ′ -TCACTCTCAGGAACGCAATATAAGATGACCCCTAAAATGGTCTCTAGATAAGTTCATG-3 ′ и 5′-CATGAACTTATCTAGAGACCATTTTAGGGGTCATCTTATATTGCGTTCCTGAGAGTGA-3 ′; Мутант CORE, 5′-TCACTCTCAGGAACGCAAGCTCAGATGCGGCCTAAAATGGTCTCTAGATAAGTTCATG-3 ‘и 5′-CATGAACTTATCTAGAGACCATTTTAGGCCGCATCTGAGCTTGCGTTCCTGAGAGTGA-3′; Мутант RORE, 5’-TCACTCTCAGGAACGCAAGCTCAGATGACCCCGCCCCTGGTCTCTAGATAAGTTCATG-3 ‘и 5′-CATGAACTTATCTAGAGACCAGGGGCGGGGTCATCTGAGCTTGCGTTCCTGAGAGTGA-3’.

Синтетические гены-репортеры т.к были получены путем отжига и лигирования следующих олигонуклеотидов в Hin DIII и Bam HI расщепляли тк-Luc вектор: дикий тип, 5′-AGCTTAACGCAAGCTCAGATGACCCCTAAAATGGAACGCAAGCTCAGATGACCCCTAAAATGGAACGCAAGCTCAGATGACCCCTAAAATGGG-3 ‘и 5′-GATCCCCATTTTAGGGGTCATCTGAGCTTGCGTTCCATTTTAGGGGTCATCTGAGCTTGCGTTCCATTTTAGGGGTCATCTGAGCTTGCGTTA-3 ′; Мутант CARE, 5’-AGCTTAACGCAATATAAGATGACCCCTAAAATGGAACGCAATATAAGATGACCCCTAAAATGGAACGCAATATAAGATGACCCCTAAAATGGG-3 ‘и 5′-GATCCCCATTTTTAGTTTGTCATCTTATATGATGCTGATGATGATGATGAT ОСНОВНОЙ мутант, 5’-AGCTTAACGCAAGCTCAGATGCGGCCTAAAATGGAACGCAAGCTCAGATGCGGCCTAAAATGGAACGCAAGCTCAGATGCGGCCTAAAATGGG-3 ‘и 5′-GATCCCCATTTTAGGCCGCATCTGAGCTTGCGTTCCATTTTAGGCCGCATCTGAGCTTGCGTT CCATTTTAGGCCGCATCTGAGCTTGCGTTA-3′; RORE мутант, 5’-AGCTTAACGCAAGCTCAGATGACCCCGCCCCTGGAACGCAAGCTCAGATGACCCCGCCCCTGGAACGCAAGCTCAGATGACCCCGCCCCTGGG-3 ‘и 5′-GATCCCCAGGGGCGGGGTCATCTGAGCTTGCGTTCCAGGGGCGGGGTCATCTGAGCTTGCGTTCCAGGGGCGGGGTCATCTGAGCTTGCGTTA-3’.Идентичность всех клонированных последовательностей проверяли секвенированием ДНК.

Первичные гепатоциты человека и образцы печени человека

нормальных гепатоцитов человека получали через Систему получения и распределения тканей печени (Питтсбург, Пенсильвания). Образцы печени человека были получены из банка тканей Центра печени Канзасского университета при Медицинском центре Канзасского университета (www.kumc.edu/livercenter).

Культура клеток и временная трансфекция

Клетки

HepG2 трансфицировали с использованием агента для трансфекции полиэтилениминового полимера, как описано ранее, и эффективность трансфекции нормализовали относительно активности β-gal из котрансфицированного вектора pCMX-β-gal (28).Для каждой трехкратной трансфекции на 48-луночный планшет трансфицировали 0,6 мкг репортера, 0,3 мкг рецепторов (pCMX-RORα, pCMX-RORγ или pCMX-HA-CAR) и 0,3 мкг pCMX-β-gal. Через двадцать четыре часа после трансфекции клетки обрабатывали носителем или 1,4-бис- [2- (3, 5, -дихлорпиридилокси)] бензолом (TCPOBOP; 5 мкм) в среде, содержащей 10% очищенный от угля / декстрана плод. бычья сыворотка в течение 24 ч перед сбором для анализа на люциферазу и β-галлон. Все трансфекции выполняли трижды и повторяли не менее трех раз.

Анализ ОТ-ПЦР в реальном времени

Тотальную РНК экстрагировали реагентом TRIzol. КДНК синтезировали из общей РНК с помощью Superscript3 (Invitrogen, Carlsbad, CA). Аликвоты кДНК амплифицировали в системе ПЦР в реальном времени ABI 7300 от Applied Biosystems (Фостер-Сити, Калифорния) с использованием мастер-микса SYBR Green PCR. Экспрессию целевой мРНК нормализовали относительно экспрессии циклофилина B (28).

Анализ сульфотрансферазы

Первичные цитозоли гепатоцитов человека или клеток HepG2 получали путем гомогенизации клеток в 5 мМ буфере KPO 4 (pH 6.5), содержащий 0,25 моль сахарозы. Анализ сульфотрансферазы проводили, как описано ранее (29). [ 35 S] -фосфоаденозинфосфосульфат (PAPS) от PerkinElmer (Waltham, MA) использовали в качестве донора сульфата. Вкратце, 20 мкг / мл общих цитозольных белков клеток инкубировали с 5 мкМ DHEA и [ 35 S] PAPS при 37 ° C в течение 20 мин. После реакции свободный [ 35 S] PAPS удаляли экстракцией этилацетатом. Затем водную фазу подсчитывали на сцинтилляционном счетчике LS6500 (Beckman, Palo Alto, CA) на радиоактивность.Контрольные реакции без субстрата также проводили параллельно, и каждую реакцию проводили в трех повторностях.

Анализ сдвига электрофоретической подвижности

Рецепторные белки

получали с использованием системы транскрипции / трансляции T7 Quick Coupled Transcription / Transcription System in vitro и системы трансляции от Promega. Реакция связывания 20 мкл содержала 2 мкл радиоактивного зонда, 2 мкл белка RORα, RORγ или CAR / ретиноид X-рецептор (RXR) -α T7 Quick Coupled Transcription / Transcription System, 1 мкл полидезоксиинозин-дезоксицитозина, 4 мкл. 5-кратного буфера для связывания и 5 мкл холодного конкурента, если применимо.Для доведения конечного объема до 20 мкл использовали стерильную воду. Реакции выдерживали при комнатной температуре в течение 20 мин перед электрофорезом через 5% -ный полиакриламидный гель в 0,5 × Трис-борат-ЭДТА при 4 ° С в течение 1–3 ч. Для конкурентных экспериментов к реакциям добавляли немеченые (холодные) олигонуклеотиды. Последовательности олигонуклеотидов EMSA показаны на фигурах.

Анализ иммунопреципитации хроматина (ChIP)

Клетки Huh7 с трансфекцией рецептора или без нее обрабатывали носителем или TCPOBOP (5 мкМ) в течение 24 ч перед анализом ChIP, как описано ранее (28, 30).Клетки Huh7 были выбраны для анализа ChIP, потому что по не охарактеризованным причинам клетки Huh7 вместо клеток HepG2 давали более надежные и воспроизводимые результаты ChIP, как мы сообщали ранее (40). Лизаты клеток инкубировали в течение ночи с 1 мкг антитела против RORα или против RORγ от Santa Cruz Biotechnology (Санта-Крус, Калифорния) или антитела против CAR от R&D Systems (Миннеаполис, Миннесота) при 4 ° C. Параллельные образцы инкубировали с нормальный IgG в качестве отрицательного контроля. Были использованы следующие праймеры для ПЦР: SULT2A1 CARE / RORE прямой, 5′-GTTTGCACTCAAACCTTAAG-3 ‘и обратный, 5′-CCAGCATGTCACATGTTTG-3′; CYP2B6 прямой, 5’-AAGCACTTCACGCCTCCC-3 ‘и обратный, 5′-CCCAGGAGGAGCAGACAAA-3′; аполипопротеин (Apo) -A-V прямой, 5’-TGGGTAGTTGTGTAAGAGAGGGG-3 ‘и обратный, 5′-ATGAGTGCCCTGGTATCAGG-3’.

RORα и RORγ РНК интерференция [малая интерферирующая РНК (siRNA)]

миРНК RORα (sc-38862) и миРНК RORγ (sc-38880) были приобретены в Santa Cruz Biotechnology. Трансфекцию миРНК проводили с использованием липофектамина 2000 (Invitrogen), как мы ранее описали (40). Эффективность подавления ROR siRNA была подтверждена Вестерн-блоттингом.

Статистический анализ

Все значения выражены как среднее ± стандартное отклонение.Сравнение между группами проводилось с использованием теста Стьюдента t или однофакторного дисперсионного анализа, где это было необходимо. P <0,05 считали статистически значимым. Линейную регрессию использовали для анализа данных экспрессии в первичных гепатоцитах человека и печени человека. В дополнение к одномерному анализу был проведен анализ смешанной модели для анализа данных экспрессии с использованием нескольких предикторов (а именно RORα, RORγ и CAR) одновременно для прогнозирования экспрессии SULT2A1 в первичных гепатоцитах человека и печени человека.

Результаты

Промотор гена

hSULT2A1 был активирован RORα и RORγ, а подавление RORα / γ ингибировало экспрессию эндогенного SULT2A1

Чтобы определить, подвержен ли ген SULT2A1 человека транскрипционной регуляции с помощью ROR, мы клонировали 5′-фланкирующую область размером 500 п.н. гена SULT2A1 человека и протестировали его регуляцию с помощью RORα и RORγ с использованием временной трансфекции и репортера. генный анализ в клетках HepG2.К нашему удивлению, мы обнаружили, что этот промотор гена SULT2A1 длиной 500 п.н. был активирован котрансфекцией RORα или RORγ (рис. 1A). Тот же промотор был активирован котрансфекцией CAR мыши, и эта активация была усилена обработкой агонистом CAR TCPOBOP (рис. 1A), что согласуется с предыдущим сообщением (31). Сообщается, что сульфат холестерина является естественным лигандом RORα (32). DHEA является типичным и предпочтительным субстратом SULT2A1 (21). Индукция SULT2A1 в ROR-трансфицированных клетках HepG2 и дальнейшая индукция после обработки сульфатом холестерина была подтверждена ферментативным анализом с использованием DHEA в качестве субстрата (рис.1Б). Ответная на холестерин сульфат индукция SULT2A1 на мРНК (фиг. 1C) и ферментативных (данные не показаны) уровнях также подтверждалась в первичных гепатоцитах человека.

Рис. 1.

RORα и RORγ активировали промотор гена hSULT2A1 и индуцировали экспрессию и активность эндогенного SULT2A1, а подавление RORα / γ ингибировало экспрессию эндогенного SULT2A1. A. Клетки HepG2 временно трансфицировали репортерным геном pGL-SULT2A1 (500 п.н.) вместе с пустым вектором или указанными рецепторами и pCMX-β-gal, контролируя эффективность трансфекции.Трансфицированные клетки обрабатывали носителем или TCPOBOP (5 мкМ) в течение 24 часов, а затем собирали и анализировали на активность люциферазы и β-гал. Эффективность трансфекции нормализовали по активности β-гал. В. Индукция SULT2A1 в ROR-трансфицированных клетках HepG2 и дальнейшая индукция после обработки сульфатом холестерина (ХС) (10 мкМ, в течение ночи) подтверждали ферментативным анализом с использованием DHEA в качестве субстрата. C. C.S.-чувствительная индукция мРНК SULT2A1 в трех случаях первичных гепатоцитов человека была подтверждена с помощью ПЦР в реальном времени.Три случая включали 61-летнего мужчину, 68-летнего мужчину и 91-летнюю женщину, все кавказцы. D, клетки HepG2 трансфицировали контрольной скремблированной миРНК (siControl) или миРНК RORα и RORγ. Через 48 часов после трансфекции клетки собирали и подвергали ПЦР-анализу в реальном времени для обнаружения экспрессии эндогенного SULT2A1 . TC, TCPOBOP. *, P <0,05 (n = 3 для каждой группы).

Рис. 1.

RORα и RORγ активировали промотор гена hSULT2A1 и индуцировали экспрессию и активность эндогенного SULT2A1, а подавление RORα / γ ингибировало экспрессию эндогенного SULT2A1.A. Клетки HepG2 временно трансфицировали репортерным геном pGL-SULT2A1 (500 п.н.) вместе с пустым вектором или указанными рецепторами и pCMX-β-gal, контролируя эффективность трансфекции. Трансфицированные клетки обрабатывали носителем или TCPOBOP (5 мкМ) в течение 24 часов, а затем собирали и анализировали на активность люциферазы и β-гал. Эффективность трансфекции нормализовали по активности β-гал. В. Индукция SULT2A1 в клетках HepG2, трансфицированных ROR, и дальнейшая индукция сульфатом холестерина (C.S.) (10 мкм, в течение ночи) были подтверждены ферментативным анализом с использованием DHEA в качестве субстрата. C. C.S.-чувствительная индукция мРНК SULT2A1 в трех случаях первичных гепатоцитов человека была подтверждена с помощью ПЦР в реальном времени. Три случая включали 61-летнего мужчину, 68-летнего мужчину и 91-летнюю женщину, все кавказцы. D, клетки HepG2 трансфицировали контрольной скремблированной миРНК (siControl) или миРНК RORα и RORγ. Через 48 часов после трансфекции клетки собирали и подвергали ПЦР-анализу в реальном времени для обнаружения экспрессии эндогенного SULT2A1 .TC, TCPOBOP. *, P <0,05 (n = 3 для каждой группы).

ROR, как известно, обладают существенной конститутивной активностью за счет взаимодействия с коактиваторами ядерных рецепторов без экзогенно добавленного лиганда (31). На моделях потери функции мы показали, что подавление либо RORα, либо RORγ с помощью siRNA ингибировало экспрессию эндогенного SULT2A1 , и более выраженное ингибирование наблюдалось, когда обе изоформы ROR были подавлены (рис. 1D). ). Эффективность подавления ROR siRNA была подтверждена вестерн-блоттингом (дополнительный рис.1, опубликовано на веб-сайте The Endocrine Society’s Journals Online по адресу http://mend.endojournals.org). Эти результаты предполагают, что эндогенный SULT2A1 регулируется ROR.

Идентификация и характеристика RORE в промоторе гена

SULT2A1 , который перекрывает ранее описанный CARE

Чтобы понять механизм, с помощью которого ROR регулируют SULT2A1 , мы исследовали промотор размером 500 п.н. и обнаружили предполагаемый RORE, характеризующийся полусайтом GGGTCA, фланкированным соседними A / T-богатыми шестью нуклеотидами (рис.2А). EMSA выполняли для определения связывания ROR с SULT2A1 / RORE с использованием синтезированных рецепторных белков и 32 P-меченного олигонуклеотидного зонда. И RORα, и RORγ эффективно связывались с радиоактивно меченным SULT2A1 / RORE (фиг. 2B), но не с радиоактивно меченным мутантом SULT2A1 / RORE с мутированной A / T-богатой областью (мутант RORE, данные не показаны). Это связывание было специфическим, поскольку эффективная конкуренция за связывание была достигнута избытком немеченого SULT2A1 / RORE или ApoA-V / RORE дикого типа, но не мутантом RORE (рис.2С). ApoA-V / RORE является прототипом RORE, полученным из промотора гена ApoA-V (34). Интересно, что хотя RORα, по-видимому, имеет более сильное связывание, чем RORγ в EMSA, эффективность этих двух RORs в активации репортерного гена pGL-SULT2A1 (550 bp) была неразличима (Fig. 1A). Следовательно, аффинность связывания, оцененная с помощью EMSA, не всегда согласуется с транскрипционной активностью в анализах репортерных генов.

Рис.2.

Идентификация и характеристика RORE в промоторе гена SULT2A1 , который перекрывает CARE. A, последовательность общих сайтов связывания с CARE и RORE (, ). Мутации, предназначенные для разрушения отдельных или комбинированных связываний CAR и ROR, перечислены с мутантными нуклеотидами ( подчеркнуты, ). B. Связывание in vitro, синтезированного RORα, RORγ и CAR, с 32 P-меченной ДНК дикого типа или мутантной ДНК было продемонстрировано с помощью EMSA.Обозначены относительные плотности полос внутри одного и того же зонда. C. Связывание RORα и RORγ с ДНК дикого типа эффективно конкурировало с немечеными холодными зондами собственного или ApoA-V / RORE, но не мутантом RORE. D, Конкуренция связывания ДНК с помощью ROR и CAR. Указаны белковые отношения рецепторов.

Рис. 2.

Идентификация и характеристика RORE в промоторе гена SULT2A1 , который перекрывает CARE. A, последовательность общих сайтов связывания с CARE и RORE (, ).Мутации, предназначенные для разрушения отдельных или комбинированных связываний CAR и ROR, перечислены с мутантными нуклеотидами ( подчеркнуты, ). B. Связывание in vitro, синтезированного RORα, RORγ и CAR, с 32 P-меченной ДНК дикого типа или мутантной ДНК было продемонстрировано с помощью EMSA. Обозначены относительные плотности полос внутри одного и того же зонда. C. Связывание RORα и RORγ с ДНК дикого типа эффективно конкурировало с немечеными холодными зондами собственного или ApoA-V / RORE, но не мутантом RORE.D, Конкуренция связывания ДНК с помощью ROR и CAR. Указаны белковые отношения рецепторов.

Интересно, что SULT2A1 / RORE перекрывается и имеет общий полу-сайт с ранее описанным инвертированным повтором, разнесенным двумя нуклеотидными (IR2) -типами CARE в том же промоторе (Fig. 2A и Ref. 28). Как показано EMSA на фиг. 2B, мутация общего полусайта (названного мутантом CORE) отменяет связывание как ROR, так и CAR. Мутация другого полусайта IR2 (названного мутантом CARE) почти, хотя и не полностью, отменила связывание CAR, но сохранила связывание ROR, судя по относительной плотности полос сдвига.Напротив, мутация AT-богатого полусайта RORE (называемого мутантом RORE) устраняет связывание RORγ и существенно снижает связывание RORα, но сохраняет связывание CAR. В реакциях связывания, которые содержали как CAR / RXR, так и RORα / γ, возрастающие количества любого рецептора усиливали их родственное связывание (фиг. 2D). Интересно, что повышенное количество CAR / RXR было эффективным для уменьшения связывания RORα / γ, тогда как увеличенное количество RORα / γ не устраняло, а скорее увеличивало связывание CAR / RXR (рис.2D). Эти результаты предполагают, что связывание этого общего сайта с помощью CAR / RXR и RORα / γ может быть не просто конкурентным. Мы не можем исключить возможность того, что связывание RORα / γ и CAR является кооперативным.

ChIP-анализ использовали для определения возможности рекрутирования эндогенных ROR на промотор гена SULT2A1 в клетках. Как показано на фиг. 3A, иммунопреципитация на лизате ДНК клеток Huh7 с помощью антител против RORα и анти-CAR выявила специфическое привлечение RORα и CAR в последовательность 218 пар оснований, охватывающую SULT2A1 / RORE-CARE, соответственно.Напротив, не наблюдали амплификации, когда тот же осадок амплифицировали с использованием пары контрольных праймеров, разработанных для дистальной области примерно на 5 т.п.н. выше SULT2A1 / RORE. Также наблюдалось рекрутирование RORγ на SULT2A1 / RORE (фиг. 3A, , правая панель, ). Сходный паттерн рекрутирования ROR на SULT2A1 / RORE наблюдался, когда клетки Huh7 временно трансфицировали RORα или RORγ (фиг. 3B). В качестве положительного контроля и, как и ожидалось, RORα и RORγ были также задействованы на ApoA-V / RORE в клетках, трансфицированных ROR (фиг.3Б). Рекрутирование трансфицированного гемагглютинина (HA) -CAR на SULT2A1 / RORE-CARE было также подтверждено анализом ChIP, в котором набор HA-CAR на CYP2B6 / CARE был включен в качестве положительного контроля (рис. 3C). . Результаты ChIP показали, что как эндогенные, так и трансфицированные ROR и CAR могут быть рекрутированы на промотор гена SULT2A1 .

Рис. 3.

Рекрутирование RORα и RORγ на промотор гена SULT2A1 , как показано с помощью анализа ChIP.A и B, сшитая формальдегидом ДНК была экстрагирована из клеток Huh-7 без (A) или с (B и C) трансфекциями указанного рецептора с использованием указанных антител. Конечные экстракты ДНК амплифицировали с помощью ПЦР с использованием пар праймеров, охватывающих SULT2A1 / RORE. Привлечение рецептора к дистальному промотору в A и ApoA-V / RORE в B было включено в качестве отрицательного и положительного контролей соответственно. C. Привлечение трансфицированного HA-CAR на промотор гена SULT2A1 , как показано с помощью анализа ChIP.Привлечение CAR к CYP2B6, / CARE было включено в качестве положительного контроля.

Рис. 3.

Рекрутирование RORα и RORγ на промотор гена SULT2A1 , как показано с помощью анализа ChIP. A и B, сшитая формальдегидом ДНК была экстрагирована из клеток Huh-7 без (A) или с (B и C) трансфекциями указанного рецептора с использованием указанных антител. Конечные экстракты ДНК амплифицировали с помощью ПЦР с использованием пар праймеров, охватывающих SULT2A1 / RORE. Привлечение рецептора к дистальному промотору в A и ApoA-V / RORE в B было включено в качестве отрицательного и положительного контролей соответственно.C. Привлечение трансфицированного HA-CAR на промотор гена SULT2A1 , как показано с помощью анализа ChIP. Привлечение CAR к CYP2B6, / CARE было включено в качестве положительного контроля.

Затем мы использовали анализы репортерных генов и сайт-направленный мутагенез для определения функциональной значимости RORE и его перекрытия с CARE. Синтетические репортерные гены люциферазы tk-SULT2A1, содержащие три копии RORE-CARE дикого типа (WT) или мутантных генов RORE-CARE, были сконструированы и трансфицированы в клетки HepG2 вместе с векторами экспрессии для RORα, RORγ или CAR.Как показано на фиг. 4Aa, котрансфекция с помощью CAR активировала репортерный ген tk-SULT2A1 WT, и эта активация была отменена мутацией CARE (фиг. 4Ab), что согласуется с предыдущим сообщением (31). Однако на трансактивацию репортерного гена с помощью CAR не повлияла мутация RORE (рис. 4Ac). Мутация RORE, с другой стороны, отменяет трансактивацию с помощью RORα или RORγ, не влияя на трансактивацию с помощью CAR (рис. 4Ac). Когда общий полу-сайт был мутирован (коровая мутация), репортерный ген больше не активировался ни CAR, ни ROR (рис.4Ad).

Рис. 4.

Функциональная характеристика RORE и его совпадение с CARE с использованием анализов репортерных генов. Клетки HepG2 временно трансфицировали синтетическим промотором-репортером tk-WT (A) или естественным промоторным репортером ( pGL-SULT2A1 ) (B) или их соответствующими мутантными вариантами (A ad и B ac, соответственно) вместе с пустой вектор или указанные рецепторы. Когда применимо, трансфицированные клетки обрабатывали носителем или TCPOBOP (5 мкМ) в течение 24 часов перед сбором клеток и анализами активности люциферазы и β-гал.Эффективность трансфекции нормализовали по активности β-гал. Все данные в B выражены относительно базовой активности промотора WT из фиг. 1A, которая была произвольно определена как 1. TC, TCPOBOP. *, P <0,05 (n = 3 для каждой группы).

Рис. 4.

Функциональная характеристика RORE и его совпадение с CARE с использованием анализов репортерных генов. Клетки HepG2 временно трансфицировали синтетическим промотором-репортером tk-WT (A) или естественным промоторным репортером ( pGL-SULT2A1 ) (B) или их соответствующими мутантными вариантами (A ad и B ac, соответственно) вместе с пустой вектор или указанные рецепторы.Когда применимо, трансфицированные клетки обрабатывали носителем или TCPOBOP (5 мкМ) в течение 24 часов перед сбором клеток и анализами активности люциферазы и β-гал. Эффективность трансфекции нормализовали по активности β-гал. Все данные в B выражены относительно базовой активности промотора WT из фиг. 1A, которая была произвольно определена как 1. TC, TCPOBOP. *, P <0,05 (n = 3 для каждой группы).

Затем мы оценили функциональность RORE-CARE в контексте природного промотора pGL-SULT2A1 , который содержит промотор гена SULT2A1 длиной 500 п.н. (рис.1). В соответствии с результатами синтетических репортерных генов tk, мутация CARE (фиг. 4Ba) и мутация RORE (фиг. 4Bb) отменяли трансактивацию с помощью CAR и ROR, соответственно. Корневая мутация отменяет трансактивацию как CAR, так и ROR (рис. 4Bc). В контексте pGL-SULT2A1 , CARE mut и CORE mut, но не RORE mut, вызывали умеренное, но значительное снижение базальной активности репортерных генов (данные не показаны).

Экспрессия

SULT2A1 положительно коррелировала с экспрессией RORα и RORγ в первичных гепатоцитах человека и печени человека

Установив SULT2A1 в качестве гена-мишени ROR, мы предположили, что экспрессия SULT2A1 в первичных гепатоцитах человека или тканях печени человека может быть положительно коррелирована с экспрессией ROR α и ROR γ.Чтобы проверить эту гипотезу, были собраны общие РНК из 21 случая первичных гепатоцитов человека и подвергнуты ПЦР-анализу в реальном времени на экспрессию SULT2A1 , ROR α и ROR γ. Демографическая информация по 21 субъекту обобщена в дополнительной таблице 1. Линейный регрессионный анализ показал, что экспрессия SULT2A1 была положительно и значимо коррелировала с экспрессией ROR α и ROR γ (рис.5А). Экспрессия SULT2A1 в гепатоцитах человека также положительно коррелировала с экспрессией CAR (фиг. 5A), что согласуется с представлением о том, что SULT2A1 является геном-мишенью CAR (31). Положительная корреляция между экспрессией SULT2A1 и ROR / CAR также наблюдалась в 27 случаях образцов печени человека (рис. 5B), что дополнительно подтверждает нашу гипотезу о том, что экспрессия SULT2A1 положительно регулируется ROR в vivo .

Рис. 5.

Экспрессия SULT2A1 положительно коррелировала с экспрессией ROR α и ROR γ в первичных гепатоцитах человека и печени человека. Двадцать один случай первичных образцов гепатоцитов человека (A) и 27 случаев человеческой печени (B) был проанализирован на предмет экспрессии мРНК SULT2A1 , ROR α, ROR γ и CAR в режиме реального времени. ПЦР-анализ. Бриллианты представляют отдельных пациентов.Корреляции анализировали с помощью линейной регрессии.

Рис. 5.

Экспрессия SULT2A1 положительно коррелировала с экспрессией ROR α и ROR γ в первичных гепатоцитах человека и печени человека. Двадцать один случай первичных образцов гепатоцитов человека (A) и 27 случаев человеческой печени (B) был проанализирован на предмет экспрессии мРНК SULT2A1 , ROR α, ROR γ и CAR в режиме реального времени. ПЦР-анализ. Бриллианты представляют отдельных пациентов. Корреляции анализировали с помощью линейной регрессии.

В дополнение к одномерному линейному регрессионному анализу мы также выполнили анализ смешанной модели, в котором несколько предикторов, а именно RORα, RORγ и CAR, одновременно использовались для прогнозирования экспрессии SULT2A1 в первичных гепатоцитах человека и печени человека. . Как показано в таблице 1, в смешанной модели положительная ассоциация ROR α оставалась значительной, а связь CAR была близка к значимой, но ассоциация ROR γ не была значимой в первичных гепатоцитах человека.В образцах печени человека смешанная модель не обнаружила значимых ассоциаций (данные не показаны). Эффект коррелированных предикторов и небольшие размеры выборки могли поставить под угрозу прогнозные значения ROR и CAR в смешанной модели. Из-за небольшого размера выборки мы не включили эффекты взаимодействия трех предикторов в анализ смешанной модели. Дополнительным фактором риска в образцах печени человека является наличие нескольких групп заболеваний.

Таблица 1.

Анализ смешанной модели 21 случая первичных гепатоцитов человека

4 9146 9146 4 9146 9149 0,02494 0,03457 4 9146 9149 0,02494 0,03457 4 9146
Решение для фиксированных эффектов .
Эффект . Оценка . se . DF . т стоимость . P значение .
RORα 0,1319 0,02945 17 4.48 0,0003
RORγ 0,03457 0,02487 17 1,39 0,1825
CAR 0,07206
0,07206 3 0,07206 3 0,07206 3 0,07206 3 0
Решение для фиксированных эффектов .
Эффект . Оценка . se . DF . т стоимость . P значение .
RORα 0,1319 0,02945 17 4,48 0,0003
RORγ 0,03457
0,03457
0,02487 0,03673 17 1.96 0,0663
Таблица 1.

Анализ смешанной модели 21 случая первичных гепатоцитов человека

Решение для фиксированных эффектов .
Эффект . Оценка . se . DF . т стоимость . P значение .
RORα 0.1319 0,02945 17 4,48 0,0003
RORγ 0,03457 0,02487 17 1,39 14 0,18256 1,39 14 0,18256 14 0,18256 0,0663
4 9146 9146 4 9146 9146 4 9146
Решение для фиксированных эффектов .
Эффект . Оценка . se . DF . т стоимость . P значение .
RORα 0,1319 0,02945 17 4,48 0,0003
RORγ 0,03457
0,03457
0,03457
0,0345 .07206 0,03673 17 1,96 0,0663

Экспрессия

ROR α, ROR γ, CAR и SULT2A1

27 случаев образцов печени человека, проанализированных на рис. 5B, включали семь случаев нормальной патологии, шесть случаев стеатоза / стеатогепатита, восемь случаев фиброза печени и шесть случаев гепатоцеллюлярной карциномы (ГЦК).Демографические данные 27 субъектов суммированы в дополнительной таблице 2. Патологии заболеваний были определены клинически. Профиль экспрессии репрезентативного липогенного гена стеароил-КоА-десатуразы 1 и фиброгенных генов , TGF β и α-актина гладких мышц показан на дополнительном рисунке 2. Когда образцы печени были сгруппированы по заболеваниям и сравнены с нормальными субъектами, мы обнаружили что экспрессия мРНК ROR α (фиг. 6A) и ROR γ (фиг.6B) был значительно ниже у пациентов со стеатозом / стеатогепатитом, фиброзом печени и HCC. Интересно, что эффект этого заболевания показал определенную рецепторную специфичность, поскольку стеатоз / стеатогепатит и фиброз печени мало влияли на экспрессию мРНК CAR в печени, хотя у HCC также была сниженная, но детектируемая экспрессия CAR (фиг. 6C). О существенном снижении экспрессии CAR , особенно при поздней стадии ГЦК, также сообщалось другими (35). Уровни мРНК SULT2A1 также были снижены при ГЦК, но не у пациентов со стеатозом / стеатогепатитом и фиброзом печени (рис.6D).

Рис. 6.

На экспрессию ROR α, ROR γ, CAR и SULT2A1 влияли заболевания печени. 27 случаев заболевания печени человека были разделены на нормальные и три группы болезней, а также относительная экспрессия ROR α (A), ROR γ (B), CAR (C) и SULT2A1 (D). в группах болезней сравнивали с таковыми из нормальной группы. *, P <0.05. Н.С., Статистически не значимо.

Рис. 6.

На экспрессию ROR α, ROR γ, CAR и SULT2A1 влияли заболевания печени. 27 случаев заболевания печени человека были разделены на нормальные и три группы болезней, а также относительная экспрессия ROR α (A), ROR γ (B), CAR (C) и SULT2A1 (D). в группах болезней сравнивали с таковыми из нормальной группы. *, P <0.05. Н.С., Статистически не значимо.

Обсуждение

В этом исследовании мы показали, что RORα и RORγ положительно регулируют экспрессию человеческого гена SULT2A1 , что противоположно ранее описанной негативной регуляции гена Sult2a1 грызунов теми же рецепторами (16). Механически ROR регулируют экспрессию гена SULT2A1 путем связывания с RORE, которая перекрывается с ранее описанной CARE. Экспрессия SULT2A1 индивидуально и положительно коррелировала с экспрессией ROR α и ROR γ в первичных гепатоцитах человека и в печени человека.

Видоспецифический эффект RORs на экспрессию SULT2A1 представляет интерес. Было высказано предположение, что мышь Sult2a1 негативно регулируется ROR, поскольку экспрессия Sult2a1 была повышена у мышей, дефицитных по RORα и / или RORγ, тогда как сверхэкспрессия ROR дикого типа или конститутивно активированная ROR подавляла экспрессию Sult2a1 в первичных гепатоцитах мыши или интактной печени мышей (16). Механизм негативной регуляции мышиных Sult2a1 с помощью RORs еще предстоит определить.Положительная регуляция ROR SULT2A1 человека подтверждается анализом промоторов, а также положительной корреляцией между экспрессией SULT2A1 и ROR в гепатоцитах человека и печени человека. Наш промоторный анализ показал, что модуль RORE-CARE не был консервативен в промоторе мышиного гена Sult2a1 (данные не показаны), что дает правдоподобное объяснение видоспецифического эффекта ROR на экспрессию этой изоформы сульфотрансферазы.Однако мы не можем исключить возможность того, что механизмы, отличные от отсутствия RORE в промоторе гена Sult2a1 мыши, могли также вносить вклад в видоспецифический эффект ROR на регуляцию SULT2A1 . Сообщалось о видоспецифической регуляции генов метаболических ферментов для других ядерных рецепторов, таких как специфическая для грызунов регуляция Sult1e1 / Est (19) и Cyp7a1 (36) с помощью LXR.

Ранее сообщалось, что SULT2A1 положительно регулируется CAR посредством CARE типа IR2 (31).Интересно, что мы обнаружили, что RORE разделяет половину сайта с CARE, и существенная роль отдельных полусайтов была подтверждена нашим анализом мутагенеза в EMSA и анализах репортерных генов. Как ROR, так и CAR, как известно, проявляют значительную конститутивную активность за счет конститутивного рекрутирования коактиваторов ядерных рецепторов (33, 37). Иерархия этих двух рецепторов в их регуляции SULT2A1 еще предстоит определить. Вполне возможно, что степень этого перекрытия будет зависеть от ряда факторов, таких как относительное сродство к рецепторам, доступность эндогенных или экзогенных лигандов и уровни экспрессии рецептора среди различных тканей.Сообщалось также о совместной регуляции CYP2C8 с помощью ROR и CAR через независимые ответные элементы ДНК (38).

Значение in vivo для SULT2A1 , являющегося транскрипционной мишенью для ROR и CAR, подтверждается положительной корреляцией между ферментом и рецепторами в первичных гепатоцитах человека и в образцах печени человека, предполагая, что экспрессия ROR или CAR имела значение для прогнозирования экспрессии SULT2A1 у пациентов.Субстраты для SULT2A1 включают желчные кислоты (20), гидроксистероид дегидроэпиандростерон (21) и родственные андрогены. Положительная регуляция SULT2A1 ядерными рецепторами, такими как PXR (22, 39), CAR (23) и LXR (24, 40, 41), вовлечена в восприимчивость животных к холестазу, гомеостазу андрогенов и токсичности ацетаминофена. Необходимы дальнейшие исследования, чтобы определить, может ли экспрессия ROR и CAR , индивидуально или в комбинации, использоваться в качестве биомаркера для прогнозирования предрасположенности к этим заболеваниям у людей.Наши результаты также показали, что на экспрессию ROR α и ROR γ отрицательно влияли несколько заболеваний печени, включая стеатоз / стеатогепатит, фиброз и HCC. Остается определить, играет ли снижение экспрессии ROR причинную роль в этих состояниях или может быть вторичным по отношению к возникновению и прогрессированию заболеваний.

Таким образом, мы установили ROR как положительные регуляторы транскрипции SULT2A1 .Наши результаты также предполагают, что экспрессия ROR α и ROR γ может иметь значения для прогнозирования экспрессии SULT2A1 , а также восприимчивости к определенным заболеваниям и токсичности лекарств, при которых экспрессия и / или регуляция SULT2A1 играет роль. Обнадеживает тот факт, что существенный прогресс был достигнут в идентификации, разработке и характеристике химических модуляторов ROR (13-15, 32), которые могут помочь использовать терапевтический потенциал ROR.

Благодарности

Мы благодарим Линхао Ли за его помощь в работе с гепатоцитами и Цзян Ли за некоторые ПЦР-зонды в реальном времени.

Эта работа была поддержана грантом Национального института здравоохранения (ES019629) и стипендией для приглашенных студентов от Китайского совета по стипендиям правительства Китая (№ 2008638059). Нормальные гепатоциты человека были получены через Систему снабжения и распределения тканей печени (Питтсбург, Пенсильвания), которая финансировалась Национальным институтом здравоохранения по контракту (N01-DK-7-0004 / HHSN267200700004C).

Раскрытие информации: авторам нечего раскрывать.

Сокращения

  • Апо

  • АВТОМОБИЛЯ

    конститутивный андростан рецепторов

  • CARE

  • ЧИП

    хроматин иммунопреципитации

  • ДГЭА

  • HA

  • ГЦК

  • IR2

    инвертированный повтор отстоят друг от друга двумя нуклеотидами

  • LXR

  • PAPS

    phosphoadenosine phosphosulfate

  • PXR

  • ROR

    ретиноид, связанной с сиротой рецептора

  • RORE

  • RXR

  • siRNA

  • SULT

  • TCPOBOP

    1, 4-бис- [2- (3, 5, -дихлорпиридилокси)] бензол

  • 6
  • WT

  • 6
  • WT

    1.

    Jetten

    AM

    ,

    Kurebayashi

    S

    ,

    Ueda

    E

    2001

    Подсемейство ядерных орфанных рецепторов ROR: критические регуляторы множества биологических процессов.

    Prog Nucleic Acid Res Mol Biol

    69

    :

    205

    247

    2.

    Carlberg

    C

    ,

    Hooft van Huijsduijnen

    R

    ,

    Deamar

    ,

    Staple

    JF

    ,

    Becker-André

    M

    1994

    RZR, новое семейство орфанных рецепторов, связанных с ретиноидами, которые действуют как мономеры и гомодимеры.

    Mol Endocrinol

    8

    :

    757

    770

    3.

    Hamilton

    BA

    ,

    Frankel

    WN

    ,

    Kerrebrock

    000 AW

    ,

    W

    ,

    Кусуми

    K

    ,

    Russell

    LB

    ,

    Mueller

    KL

    ,

    van Berkel

    V

    ,

    Birren

    000

    000

    000 Krugly

    ak

    000 Krugly

    ak

    000

    000 Krugly

    ES

    1996

    Нарушение рецептора ядерного гормона RORα у мышей staggerer.

    Nature

    379

    :

    736

    739

    4.

    Steinmayr

    M

    ,

    André

    E

    ,

    Conquet

    F

    ,

    ig2 Rondha

    ,

    Rondha -Bouchaud

    N

    ,

    Auclair

    N

    ,

    Daniel

    H

    ,

    Crépel

    F

    ,

    Mariani

    J

    ,

    Sotelo

    C2

    1998

    Фенотип Staggerer у мышей с дефицитом альфа орфанных рецепторов, связанных с ретиноидами.

    Proc Natl Acad Sci USA

    95

    :

    3960

    3965

    5.

    André

    E

    ,

    Conquet

    F

    ,

    Steinmayr

    M

    M

    Porciatti

    V

    ,

    Becker-André

    M

    1998

    Нарушение работы орфанного рецептора β, связанного с ретиноидами, изменяет циркадное поведение, вызывает дегенерацию сетчатки и приводит к фенотипу Vacillans у мышей.

    EMBO J

    17

    :

    3867

    3877

    6.

    Медведев

    A

    ,

    Ян

    ZH

    ,

    Hirose

    T Jet

    ,

    Gigabit

    AM

    1996

    Клонирование кДНК, кодирующей мышиный сиротский рецептор RZR / RORγ, и характеристика его ответного элемента.

    Джин

    181

    :

    199

    206

    7.

    Giguère

    V

    ,

    Tini

    M

    ,

    Flock

    G

    ,

    Ong

    E

    ,

    Evans

    RM

    ,

    000

    000

    000

    амино-концевые домены определяют ДНК-связывающие свойства RORα, нового семейства ядерных рецепторов орфанных гормонов.

    Genes Dev

    8

    :

    538

    553

    8.

    Harding

    HP

    ,

    Atkins

    GB

    ,

    Jaffe

    AB

    ,

    Seo

    ,

    MA

    1997

    Активация и репрессия транскрипции с помощью RORα, орфанного ядерного рецептора, необходимого для развития мозжечка.

    Mol Endocrinol

    11

    :

    1737

    1746

    9.

    Jarvis

    CI

    ,

    Staels

    B

    ,

    Brugg

    B

    igre

    Tedgui

    A

    ,

    Mariani

    J

    2002

    Возрастные фенотипы у мышей staggerer расширяют роль ядерного рецептора RORα за пределы мозжечка.

    Эндокринол клеток Mol

    186

    :

    1

    5

    10.

    Мамонтова

    A

    ,

    Séguret-Macé

    S

    ,

    Esposito

    B

    ,

    Chaniale

    C

    ,

    Bouly

    M

    M

    G

    ,

    Staels

    B

    ,

    Duverger

    N

    ,

    Mariani

    J

    ,

    Tedgui

    A

    1998

    Тяжелая атеропротеагеальная атеросклеремия у мышей с ядерной и мутной атеросклерозой. рецептор RORα.

    Обращение

    98

    :

    2738

    2743

    11.

    Андре

    E

    ,

    Gawlas

    K

    ,

    Becker-André

    орфанный ядерный рецептор RORβ специфически экспрессируется в шишковидной железе и сетчатке.

    Джин

    216

    :

    277

    283

    12.

    Куребаяши

    S

    ,

    Уэда

    E

    ,

    Sakaue

    000 M

    000

    000 Med

    000 DD

    000 A

    ,

    Zhang

    F

    ,

    Jetten

    AM

    2000

    Ретиноидный орфанный рецептор γ (RORγ) необходим для лимфоидного органогенеза и контролирует апоптоз во время тимопоэза.

    Proc Natl Acad Sci USA

    97

    :

    10132

    10137

    13.

    Jin

    L

    ,

    Martynowski

    D

    ,

    Zheng

    S

    Xie

    W

    ,

    Li

    Y

    2010

    Структурная основа гидроксихолестеринов как природных лигандов орфанного ядерного рецептора RORγ.

    Мол. Эндокринол

    24

    :

    923

    929

    14.

    Wang

    Y

    ,

    Kumar

    N

    ,

    Solt

    LA

    ,

    Richardson

    TI

    ,

    Helvering

    LM

    0003,

    Crumbley

    ,

    Stayrook

    KR

    ,

    Zhang

    X

    ,

    Novick

    S

    ,

    Chalmers

    MJ

    ,

    Griffin

    PR

    000

    000

    000

    000 Burris2000 Связанный с рецептором ретиноевой кислоты орфанный рецептор α и гамма-активность 7-оксигенированных стериновых лигандов.

    J Biol Chem

    285

    :

    5013

    5025

    15.

    Solt

    LA

    ,

    Kumar

    N

    ,

    Nuhant

    Wang

    P

    ,

    P

    JL

    ,

    Лю

    J

    ,

    Istrate

    MA

    ,

    Kamenecka

    TM

    ,

    Roush

    WR

    ,

    Vidoviç

    000 SC

    0002 Vidoviç

    J

    ,

    Wagoner

    G

    ,

    Drew

    PD

    ,

    Griffin

    PR

    ,

    Burris

    TP

    2011

    Подавление иммунитета с помощью синтетической и синтетической иммунной системы.

    Природа

    472

    :

    491

    494

    16.

    Канг

    HS

    ,

    Анже

    M

    ,

    Клюв

    JY

    ,

    Wu 9000 JM

    ,

    Wada

    T

    ,

    Xie

    W

    ,

    Collins

    JB

    ,

    Grissom

    SF

    ,

    Jetten

    AM

    2007 9000: роль регулятора экспрессии гена RORα и RORγ в фазе I и фазе метаболизма II.

    Physiol Genomics

    31

    :

    281

    294

    17.

    Wada

    T

    ,

    Канг

    HS

    ,

    Анже

    M

    ha

    Gong

    S

    ,

    Khadem

    S

    ,

    Ren

    S

    ,

    Ellis

    E

    ,

    Strom

    SC

    ,

    Jetten

    AM

    ,

    2008

    000

    Xie

    000 W

    000 Идентификация оксистерин-7α-гидроксилазы (Cyp7b1) как нового гена-мишени орфанного рецептора α (RORα) (NR1F1), связанного с ретиноидами, и функциональная перекрестная связь между RORα и Х-рецептором печени (NR1h4).

    Mol Pharmacol

    73

    :

    891

    899

    18.

    Chen

    Y

    ,

    Coulter

    S

    ,

    Jetten

    AM

    000

    Goldstein

    Идентификация человеческого CYP2C8 как гена-мишени орфанного ядерного рецептора, связанного с ретиноидами.

    J Pharmacol Exp Ther

    329

    :

    192

    201

    19.

    Falany

    CN

    1997

    Энзимология цитозольных сульфотрансфераз человека.

    FASEB J

    11

    :

    206

    216

    20.

    Радоминская

    A

    ,

    Comer

    KA

    ,

    Zimniak

    000 I 9000 Falany

    9000 Falany

    M

    ,

    Falany

    CN

    1990

    Стероид-сульфотрансфераза печени человека, сульфаты желчных кислот.

    Biochem J

    272

    :

    597

    604

    21.

    Otterness

    DM

    ,

    Wieben

    ED

    ,

    Wood

    TC

    ,

    Watson

    WG

    ,

    Madden

    BJ

    ,

    McCorm2000

    ,

    McCorm2000 DJ

    1992

    Дегидроэпиандростеронсульфотрансфераза печени человека: молекулярное клонирование и экспрессия кДНК.

    Mol Pharmacol

    41

    :

    865

    872

    22.

    Sonoda

    J

    ,

    Xie

    W

    ,

    Rosenfeld

    JM

    ,

    Barwick

    JL

    ,

    Guzelian

    PS

    Эванс

    Каскад сульфирования ксенобиотиков ядерным прегнаном X-рецептором (PXR).

    Proc Natl Acad Sci USA

    99

    :

    13801

    13806

    23.

    Saini

    SP

    ,

    Sonoda

    J

    ,

    Xu

    9000

    L

    Uppal

    H

    ,

    Mu

    Y

    ,

    Ren

    S

    ,

    Moore

    DD

    ,

    Evans

    RM

    ,

    New Xie

    W

    ro

    рецептор-опосредованный и независимый от CYP3A путь детоксикации желчных кислот.

    Mol Pharmacol

    65

    :

    292

    300

    24.

    Uppal

    H

    ,

    Saini

    SP

    ,

    Moschetta

    A

    ,

    Mu

    ,

    Mu

    J

    ,

    Gong

    H

    ,

    Zhai

    Y

    ,

    Ren

    S

    ,

    Michalopoulos

    GK

    ,

    Mangelsdorf

    000 DJ

    ,

    000

    000

    Активация LXR предотвращает токсичность желчных кислот и холестаз у самок мышей.

    Гепатология

    45

    :

    422

    432

    25.

    Фанг

    HL

    ,

    Стром

    SC

    ,

    Эллис

    E

    000

    000

    000

    000 Duan J

    ,

    Duniec-Dmuchowski

    Z

    ,

    Falany

    CN

    ,

    Falany

    JL

    ,

    Kocarek

    TA

    ,

    Runge-Morris

    Положительное регулирование

    Положительное и отрицательное транскрипции гена гидроксистероидной сульфотрансферазы печени человека (SULT2A1) рифампицином: роль ядерного фактора гепатоцитов 4α и рецептора прегнана X.

    J Pharmacol Exp Ther

    323

    :

    586

    598

    26.

    Song

    CS

    ,

    Echchgadda

    I

    ,

    Baek BS

    000

    000

    000 A Oh

    T

    ,

    Roy

    AK

    ,

    Chatterjee

    B

    2001

    Индукция гена дегидроэпиандростеронсульфотрансферазы активированным желчной кислотой рецептором фарнезоида X.

    J Biol Chem

    276

    :

    42549

    42556

    27.

    Seely

    J

    ,

    Amigh

    KS

    ,

    Suzuki

    as

    T

    T

    H

    ,

    Giguere

    V

    ,

    Laganière

    J

    ,

    Carr

    BR

    ,

    Rainey

    WE

    2005

    регуляция транскрипции эстрогендифферазы α.

    Эндокринология

    146

    :

    3605

    3613

    28.

    Ou

    Z

    ,

    Wada

    T

    ,

    Gramignoli

    R

    9000

    ,

    SC

    ,

    Huang

    M

    ,

    Xie

    W

    2011

    МикроРНК hsa-miR-613 нацелена на ген LXRα человека и опосредует петлю обратной связи авторегуляции LXRα.

    Эндокринол

    25

    :

    584

    596

    29.

    Гонг

    H

    ,

    Гуо

    P

    ,

    Чжай

    Y

    000

    000

    000 U

    ,

    H

    ,

    Jarzynka

    MJ

    ,

    Song

    WC

    ,

    Cheng

    SY

    ,

    Xie

    W

    2007

    Депривация эстрогена и подавление роста груди vivo орфанного ядерного рецептора Х-рецептора печени.

    Мол Эндокринол

    21

    :

    1781

    1790

    30.

    Чжоу

    J

    ,

    Чжай

    Y

    ,

    Mu

    Y

    ,

    Gong

    H

    ,

    Toma

    D

    ,

    Ren

    S

    ,

    Evans

    RM

    ,

    Xie

    W

    2006

    Новый регулирующий элемент прегнана X, опосредованный рецептором X и белок, связывающий стерин -независимый липогенный путь.

    J Biol Chem

    281

    :

    15013

    15020

    31.

    Echchgadda

    I

    ,

    Song

    CS

    ,

    Oh

    T

    M

    M,

    La Cruz

    IJ

    ,

    Chatterjee

    B

    2007

    Ядерные рецепторы, чувствительные к ксенобиотикам, рецептор прегнана X, конститутивный андростановый рецептор и орфанный ядерный рецептор, ядерный фактор гепатоцита 4α / стероидный фактор 4α человека в регуляции стероидной кислоты человека. -сульфотрансфераза.

    Mol Endocrinol

    21

    :

    2099

    2111

    32.

    Kallen

    JA

    ,

    Schlaeppi

    JM

    ,

    Bitsch

    000 Ge

    000

    000 Ge

    M

    ,

    Delhon

    I

    ,

    Fournier

    B

    2002

    Рентгеновская структура hRORα LBD при 1,63 A: структурные и функциональные данные о том, что холестерин или производное холестерина является естественным лигандом RORα .

    Структура

    10

    :

    1697

    1707

    33.

    Delerive

    P

    ,

    Подбородок

    WW

    ,

    Suen

    CS

    2002

    новый ген-мишень ROR (α).

    J Biol Chem

    277

    :

    35013

    35018

    34.

    Lind

    U

    ,

    Nilsson

    T

    ,

    McPheat

    ,

    K

    ,

    Balendran

    C

    ,

    Kang

    D

    2005

    Идентификация гена ApoAV человека как нового гена-мишени RORα.

    Biochem Biophys Res Commun

    330

    :

    233

    241

    35.

    Pascussi

    JM

    ,

    Роберт

    A

    ,

    Moreau

    A

    os3 Bioulac-Sage

    P

    ,

    Navarro

    F

    ,

    Blanc

    P

    ,

    Assenat

    E

    ,

    Maurel

    P

    ,

    000

    000

    000

    000

    000 Виларем

    конститутивная экспрессия рецептора андростана изоформами ядерного фактора гепатоцитов 4α.

    Гепатология

    45

    :

    1146

    1153

    36.

    Чианг

    JY

    ,

    Kimmel

    R

    ,

    Stroup

    Dles

    Hydolase (CYP7A1) транскрипция сиротским рецептором печени (LXRα).

    Джин

    262

    :

    257

    265

    37.

    Forman

    BM

    ,

    Tzameli

    I

    ,

    Choi

    HS

    000

    Chen D

    ,

    Seol

    W

    ,

    Evans

    RM

    ,

    Moore

    DD

    1998

    Метаболиты андростана связываются с ядерным рецептором CAR-β и деактивируют его.

    Nature

    395

    :

    612

    615

    38.

    Chen

    Y

    ,

    Goldstein

    JA

    2009

    Транскрипционная регуляция генов CYP2C человека.

    Curr Drug Metab

    10

    :

    567

    578

    39.

    Zhang

    B

    ,

    Cheng

    Q

    ,

    Ou

    Z

    ,

    X

    ,

    M

    ,

    Kochhar

    U

    ,

    Ren

    S

    ,

    Huang

    M

    ,

    Pflug

    BR

    ,

    Xie

    W

    2010

    терапевтическое средство мишень для подавления активности андрогенов.

    Эндокринология

    151

    :

    5721

    5729

    40.

    Lee

    JH

    ,

    Gong

    H

    ,

    Khadem

    S

    S Lu

    X

    ,

    Li

    S

    ,

    Zhang

    J

    ,

    Xie

    W

    2008

    Депривация андрогенов путем активации Х-рецепторов печени.

    Эндокринология

    149

    :

    3778

    3788

    41.

    Saini

    SP

    ,

    Zhang

    B

    ,

    Niu

    Y

    ,

    Jiang

    M

    ,

    Gao

    J

    ,

    000 Zhai

    J

    ,

    000 Zhai

    Uppal

    H

    ,

    Tian

    H

    ,

    Tortorici

    MA

    ,

    Poloyac

    SM

    ,

    Qin

    W

    ,

    Wenkataramanan 9000 9000 R9000 9000 R 9000 9000 9000 9000 R 9000 9000 9000 R 9000 2011

    Активация LXR увеличивает клиренс ацетаминофена и предотвращает его токсичность у мышей.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *